ZFIN ID: ZDB-TSCRIPT-090929-12659
Transcript Name: arhgef1a-001
Previous Name: arhgef1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030456 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030456|OTTDARG00000023391|ZDB-GENE-030722-5 arhgef1a|OTTDARP00000024813 arhgef1-001 LG_ CT573147.7 Danio rerio protein_coding KNOWN, 4238 bp
GCCGCACCGCGCTGCTCTATGACTGTCTCCTGCCTTACTA
AAACGCTGAAATTATACAAACAAGCGGCCAAACGGAACTT
TTATCTTAATTAATGGGATATACATATGCTTTTACCGTAA
GAAGACTCGTTTTTCGGTGTATTAAAGACGTTTAACAAAT
CGCAATGTCTCGAGTAGCGGATCTGTCGAAACTTCGCCAG
GAGAGGATGAGAGAGATCAGTCAGCGGAATAAGGAGAAGG
AGCGCATGAGGGAGCGGGAGAGAGAAGCGAGAGAGCGTGA
AGCACGTTACAGTAATGGCCACCTCTTCAACTGTCTCACC
GTGTCTGGAACCACTCTCTGCTCGGCCTGCAATAAGAGCA
TCACCGCTAAGGAGGCCCTCAGCTGCCCCACCTGTAACGT
CACCATACACAACCGCTGCAGGGACACACTACCAAACTGT
GTGAAAATGAAACAAAAGCAACAAAAAATGGCACTGATGA
GGAACAATTCAGCCTATCAGAACGTAACACTGAGGAATAA
AGCCCATTTAAAGGAAAGGCCGAGTTCTGCCATCTACCCT
TCAGACAGCCTTCGCCAGTCGCTACTCGGGTCCCGTCGTG
GACGCTCTTCTCTTTTACTTTCAAAGAGCGTCTCCACCAA
TAACATTGCAGGGACTCTGAATGATGACTCTCCTCTGGGG
CTGCGCAGGATTTTATCTCAATCCACAGACTCACTCAACT
TCAGGAGCAGAACCATGTCTATGGAGTCGCTCAATGATGA
GGGAGAGTGCTACGTCTCTTCTCTGCTGGAAGATCTGGAT
TGTGAAGGCCCAGAATTTGAAGCAGACTCCTGGAGCATGG
CAGTGGATTCCAGCTACTTGCAGACCCACCGTAAAGATGT
TATCAAGAGACAGGACGTCATCTACGAGCTGATCCAGACG
GAGCTTCATCATGTCCGGACGCTGCGGATCATGGACTGCG
TGTTCAGACGGGGGATGCTGGAGGAAGTGCAGCTGGAGCC
GGGGGTCGTACATGCGCTCTTCCCCTGCCTGGAGCGTCTG
CTGAGCATACACACACACTTCCTCACACAGCTCCTCGCAC
GGCGTGCTCACAGCCTGCAGCCCGGCAGCACAAACAATTT
CACCATCACTCAGATCAGCGATGTGCTAATAAAGCAGTTC
TCAGGTCAGTTTGCAGACGATATGCTGAAGGCCTATTCTG
AGTTCTGCAGTCGCCATATGAAGGCTGTCAAACTCTACAA
AGAGCTGCTGGCCAGAGACAAGAGACTTCAGCTCTTTATA
CGGAGGGTGAGTCGGGGGCCCTTACTGCGCCGTCACGGAT
TTCAGGAGTGTATCCTGCTGGTCACTCAGCGTATCACTAA
ATACCCCGTCCTACTGCAGCGAATCCATGACAACACCAAA
GACAATCTGGAGGAAGCTGCAGGCCTGTCTCAGGCTCTGG
CTTGTCTCCGCGAGCTGCTGTGTTCGGTGGATCAGCAGGT
ATTGGAGTTGGAGAGGACACATCGGCTGCAGGAGATCCGC
TCTCGAGTGGACCCGCGTGCAGAGGCCAAACTTCGTTCCG
GAGCTCTATTCCGACCGGCCGAACTGCTCCGCAGGCAGCT
TATACATGAAGGCACGCTTCTCTGGAAAACACCCAGCTCT
CGACTCAAAGATGTTCAAGTTCTGCTGATGACTGATATTC
TAGTGTTCTTGCAAGAGAAAGATCAGCGGTTTATTTTTGC
CAGTTTGGACAAGTCTGCTGTAGTGTCACTGCAGAGTCTA
TTGGTTCGAGATATAGCCAATCAGGAGCGAGGGTTGTTTC
TGATCAGCAGTGAGTCCAGCCCACCTGAGATGTACGAGCT
CTATGCGGCAAGCAAAGATGACAGAAACACCTGGCTTCGC
CTTATACAGCAGACCATCGGCAGCTGTCCGTCAAGAGAAG
AATTCCCTCTTATAGAAACAGAAGACAAGGCTCTTCTGCG
AAGACTCAAAGCTGATATCCAGCAGAAGGACAGTGAGGTG
TTGGAGCTACTACAGGAGCGAGTCACTCTGTTCTCAGACC
TGGCGGAGGTCATGGGGGGCTATGAGGTCATGCTGCCAGC
CTGCTCCAGAAACCTGTTCAGAGCTGAGTCTCCACAGGCT
CCTCGAGGAGAACAGCTGCTAACACAGGCCATAACAGAGG
TGGACAGATTGACAGAGCTGTTATTAGGATCCGGTTTAGA
GGTTCCTCTGCCCTGCAATTCCAACGGCCATCACAATCCC
CCCGGATCGCTAGTAATCAATGGACAAGAAGTATTAGTTA
ACGGATCTCAGGAGAACCAAGCTGCTCAGGACGGGAATGG
GAATCAAATGGAGGACAAGACGCCAAGTGAGGAGGTGTCA
CAGAGGCTGGTGAATCTCAGTGCTCAGTTACACGCTCTTC
AGGGTGTGGTGATACGACAGGACACCATCTTAGAGCTCTG
TCTACGAGAGAGCCCCGTCTCCCAGACCCCCTCAGGAGCT
CGCACTGTACGCTCTCTTTCCCGGGACGGAGCCAGTGACA
TGGGCTCAGTGGGTGAACTGGCCCTGCTTCAGCGGCAGCA
CAGCCTCCTGCAGGAGGAGCTGGTGCGCCTCAGAGGAGCC
GACGGCAAACTCAGGGACAGCGAGAGAGTCAGAGCTCATC
TGGAGAAACAGCTCAGGGATATGAAGACTAATAGCGCCGC
TCTAGGGGATCGAGGTGGTACTGCAGGCTCACAGGCTCCG
TCAAATCGAAGAGAGAGCGATACTGACCCCAACACTGACA
CGCCACTGGCCAGCCAGGAATCCATGGACCAATCGGACGG
CCTGCAGGAGTGCAGCGATGTGGAAGTGGATGTGATTTCG
GATGATGATGACGACGACGAAGTGGATTCAAGGGTTTCTC
CCCGTTCAGAAAGTCCCAGAGATCTGCAGGACATTCCCGA
AGAGAGTGAAACAGCTACAGACCCCCGGGAGCGTGACGCC
TCACACTGCTAATATTTTCATTTTATTTAATCTTGTTTGT
TTGTTTATTTGTTTGTTTTTATCAACCCAAGACTGGCCTG
GAACAGACTATATAGACTCACGAGCAGGTCTTCCTCCCAA
ACAGGGAAGAGTCTTATTAGTTTATGAATATTCATTTCAT
TATAACGTATTTAGTCATCTCCAGTCATTCTGCTTAGAGC
TTCTGTGTGGCCGTTTGAGACCTTCGCCTCCTTGGAATCC
AGTCATCTTCCAATATGGATTGATATGGATGTGCCAAAGC
ATGGAGATGGAGTCATGCGAATAATGGGACTTGATAGCAG
CATGAAGCGGTTGTCTTAAAATGACCTAAATCAACCAAAA
AATACGCGATCCAGCTCAAAGGTACCTGCAGAAATTATTC
CGATTTTATTTGTACTGTGTGTTAGATACTCATTAGCGTT
TAGTGTACCGATTTGACACATGCTGGAGCACGCAAACCTT
AATAGAGCTTTTTTCATTGTTGTTATTGTGTTTTTTAAAA
GTGAAATGTTTGTGAGAGGTCATTTTTAATTTATTTATTT
TCCTTTATTTTGACATTCAGGCATGTTAAAGGAGTTAGAA
AGAAGCCAAAATTACAGAATATATCAGCATAATATACTGG
GACCAAAACTACTGGCTCTTTAACTACTATATGACTATTT
TTGAAGGATGGAAAGATTTATATTGCACTTCATAGCAATA
TATAGAAATATATTTACATCCAGAGCAAATAACTGCATAA
ACCCAGGAAGGTTATTATGATATTGAGTATTATAATAATA
TTCTGAATGGTTCCTCAGCCCACAGTGTGTGTTAAGGTGG
AACTATTATTATTATTTTGTAAATAAAAGATTTATTGACT
AAAATAAATCACGTCACCAAAATCTGCCAGTAACGCCAAA
CGACATTGGACGTGTCTTACTACACTTTTGCTTGTTTTTG
ACTTTCTTTAGGAATGTTTTACTTGACTTTGTGCCAAACT
CTGCTTGGCTGAATATCGCTGAGATTTATATATATATATA
TTATGCTTTCATTTTAGTCAGTTCAACATTTCAGGAAGCA
ACGTCTTATAGGAATCATTTGTAGGATAAGATTCTACACA
TTTTGAAGTAACTACAAGGTAACGCAGGATTTACCGAAGT
CGCAAGAAATGTTTATATGGAAAAGGACTGAAACACTGGT
GAAATGTTCATGCGATGTTTCAGATATATTGCCGTGGATA
TAGAATACTGTCGAATAATTAAATCTGCTGATATACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arhgef1a-001 Contained in:
OTHER arhgef1a-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030456 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC133079 (1) 4255bp
    GenBank:CD808440 (1) 2131bp
    GenBank:CD597320 (1) 650bp
    GenBank:EB900622 (1) 591bp
    GenBank:EB898785 (1) 497bp
    GenBank:EB951133 (1) 462bp
    GenBank:BG737422 (1) 458bp
    GenBank:CD604028 (1) 443bp
    GenBank:BI473626 (1) 421bp
    CITATIONS (1)