Transcript

pkn3-201

ID
ZDB-TSCRIPT-090929-12442
Name
pkn3-201
Previous Names
  • pkn3-001
  • prkcl2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030186 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030186|OTTDARG00000023205|ZDB-GENE-030131-1902 pkn3|OTTDARP00000024597 DKEY-202G15.3-001 LG_ CR387979.25 Danio rerio protein_coding NOVEL, 3045 bp
CCGTCAAGCCTCCCAGCTGACAGACAGCCACCTGTATCTT
CTTCCAGCACACAAGTTGTACTCTATTTGAATGTTTCCTT
TGTTTGCGCTCTCAGATTCAGTTGGGAGTCTGGATATGTT
TTTTAGTTTCACTCAATCAAGCGCCGCGTGAGCGTGAGCC
AAGAAGCTCGAGCGAGGATTCGGTTAGTCTGAGCATCAGC
GCTCAGAACACTCTTTCACAATGTCGGGTGTGACGCTACA
GAGCAGCGCTCTTCAAGGTCTGGCTGAAGGGGACCTGATG
GACCCTGAGTTTCAGCAGCGTGTAGAGGATGCAATTGCTC
TTCTCCGGCAGGAGATCCAACGCGAGCTGAAGATCAAAGA
GGCGGCCGAGCGTCTACGCCGAGCAGTGACCAACCGCAAG
AGTGCTGCTGATGTGGATGGTCAGCTTAGAGCCTCCAGCC
GCAAGCTCGAGCAGCTCCACTGGGAGCTTCAGGAGCTCAA
TGCACGTGCTATGGCTACACAGAAGGAGAATGTGATGGAT
GATGCCACCTCCCCAGACCCGTGCCATTGGGAAGAAGTCA
CATCACCCTTGGGCAGTCATGTCCGTACACTGAAAAAACA
GCTTACCATGGAGCTCAAAGTGAAGCAAGGAGCTGAGAAC
ATTATCCAGACTTACACAAACAGTTCTGTCAAGGATCGGA
AGATGTTGTCCACAGCCCAGCAGATGCTGCAGGATAGTCG
GACGAAAATCGAGCTGCTCCGCATGCAGATTGTCAAAGTC
ACACAGGCCAGAGAAGGAGAGAGAGAGACCACACAGCAAG
AAGGTCGCCCTTCTGAAACAATCAGTCCTCTCGAGCTGCG
GGTGGAGGAGCTCAGGCACCATCTAAGGATTGAGGCAGCT
GTGGCAGAAGGTGCCAAAAATGTGGTTAAGCAGCTTGGTG
TCCGTAAAGTGCAAGACCGACGTGCTCTAGCGGAAGCTCA
GGCCCGTTTGCAGGAATCCTCTCAAAAACTGGACCTGTTG
CGTTTGTCTCTGGAGCAGCAGCTTGGAGAACTTCCCCAAG
ACCATCCCAAACGAGCTGCCATTAAAGAAGAGCTGACAGT
AGGTTCCTCTCCTGGTATTGGGTTGCAAAGGGAACGCCTG
CGCTCTTCATCTTCAGCATCCTCTTCTCTCTTTAAACCAG
CCAGCCTGACAGGGCGATTGGAGGTCAGGTTGATGGGTTG
TCAGGACCTGCTGGAGTCAGTTCCAGGCCGCTGTCGTGTA
AGCAACATGTCCTCCGCTCCTGGAAGTCCATCTGACTCCA
AATCACTAAGAATGAGAACCGGCCTTTCCACTCGCAGCAC
CAACGGCAAGACCACCAAGACTGATGAACTGTCATCTGAA
ATCAGTGCTGTGTTGAAAGTGGATAACAAGATTGTTGGTC
GCACACATTGGCGGCCGCTGAGTAAGGATGCCTGGAACCA
AAGCTTTAGCATCGAACTGGAGCGGTCTCGAGAACTGGAG
ATTGCTGTGTATTGGCGAGACTGGAGGTCCCTGTGTGCCG
TGAAGTTCCTGCGTTTGGAAGACTTTCTAGACAACCAGAG
GCACGGCATGTGTCTTTATCTGGAGCCGCAGGGCACACTG
TTCACAGAGGTGAGATTCATCAATCCTGTCATTGAGCGGC
ATCCTAAACTACAACGACAGAAGAGGATTTTCCCTAAAGA
AAAAGGGAAGAATTTCTTACGGGCAGCACAGATGAATATG
AATTTCGCAACTTGGGGGCGTCTGATGATGAGTGTGTTAC
CCCCCTGTAACAGCACCATTACGGCCCTCAGCCCTCCGCT
GCCTGGCTCAGAGCCGCTGTCTCCTCCATCTGTGTCCACA
CCACCCTCCACAGGAGACTCAGCAGTTGTTAAACTGAATT
TCAGCGAGGAACGGCCCACCAAGCCTCCGCGCCTTCACTT
GGCGCAGAACCCTTCAGCTGATGAATCACTTTCTGGGACT
CCTGCCAGAGTAAACTCCACTGAGGACCGCCGAGTTCTCC
AAGCCAGGCCTGCGTCCCAGCCTACAACTCAGAGGCAAGA
AGGGATGCAGATGGAGGACTTTAACTGCATTTCTGTTTTA
GGAAGAGGGCACTTTGGAAAGGTCCTTCTGGCTGAATTCA
AGAGGACTGGGAAACTTTATGCCATCAAAGCCTTGAAAAA
AGGGGATGTTGTGACCCGGGATGAAGTGGACAGTTTAATG
TGTGAAAAGAGGATTTTTGAGACCATCAATGCGTCCCGAC
ATCCTTTCCTGGTGAACCTGTACGGCTGCTTCCAGACGCC
TGACCATGTGTGTTTTGTGATGGAATATTCTCCTGGAGGA
GACCTGATGACCCACATCCACAACAACATCTTCTCTGAAC
GCCAGGCCAGGTTTTATTCTGCTTGTGTATTACTGGGCCT
GGAGTTTCTGCACCAAAACCGGATTGTCTATAGGGATCTT
AAGCTGGATAATCTGTTAATGGACTCTGATGGCTTTGTGA
GAATTGCAGATTTTGGACTTTGCAAAGAAGGTATGGGATA
TGGAGATCGTACATCAACCTTTTGTGGCACCCCAGAGTTT
CTGGCTCCAGAGGTTTTGACAGACAGCAATTACACCCGTG
CAGTGGACTGGTGGGGTCTGGGTGTGCTCATCTATGAGAT
GCTCGTTGGAGAGTCTCCATTCCCTGGTGATGATGAAGAG
GAGGTGTTTGACAGCATAGTGAATGATGAAGTGCGCTACC
CCAGGTTTATGTCTCCAGAGTCAGTCTCCGTTATCCAAAA
GCTGCTGCAGAAGAACTCTGAAAAACGACTGGGGGCAGGA
GAGCAAGATGCCAACGAAGTCAAGAAACACCGTTTTTTCC
AGGGCATTGACTGGGAGGCTCTGCTGGCCAAAAGAGTCAA
ACCTCCATTCCTGCCGTCAATTAAAACAGCAGCGGACGTC
AGTAACTTTGACGAGGAGTTCACACGCCTCAAGCCTGTCC
TGACTCCTCCACAGACGCCGTTCTTCCTTAGCGCCGAGCA
GCAGGAGTTCTTTGCGGACTTCGACTTCTCTGCCCTGCAC
TGACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations