ZFIN ID: ZDB-TSCRIPT-090929-12442
Transcript Name: pkn3-201
Previous Names: pkn3-001, prkcl2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030186 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030186|OTTDARG00000023205|ZDB-GENE-030131-1902 pkn3|OTTDARP00000024597 DKEY-202G15.3-001 LG_ CR387979.25 Danio rerio protein_coding NOVEL, 3045 bp
CCGTCAAGCCTCCCAGCTGACAGACAGCCACCTGTATCTT
CTTCCAGCACACAAGTTGTACTCTATTTGAATGTTTCCTT
TGTTTGCGCTCTCAGATTCAGTTGGGAGTCTGGATATGTT
TTTTAGTTTCACTCAATCAAGCGCCGCGTGAGCGTGAGCC
AAGAAGCTCGAGCGAGGATTCGGTTAGTCTGAGCATCAGC
GCTCAGAACACTCTTTCACAATGTCGGGTGTGACGCTACA
GAGCAGCGCTCTTCAAGGTCTGGCTGAAGGGGACCTGATG
GACCCTGAGTTTCAGCAGCGTGTAGAGGATGCAATTGCTC
TTCTCCGGCAGGAGATCCAACGCGAGCTGAAGATCAAAGA
GGCGGCCGAGCGTCTACGCCGAGCAGTGACCAACCGCAAG
AGTGCTGCTGATGTGGATGGTCAGCTTAGAGCCTCCAGCC
GCAAGCTCGAGCAGCTCCACTGGGAGCTTCAGGAGCTCAA
TGCACGTGCTATGGCTACACAGAAGGAGAATGTGATGGAT
GATGCCACCTCCCCAGACCCGTGCCATTGGGAAGAAGTCA
CATCACCCTTGGGCAGTCATGTCCGTACACTGAAAAAACA
GCTTACCATGGAGCTCAAAGTGAAGCAAGGAGCTGAGAAC
ATTATCCAGACTTACACAAACAGTTCTGTCAAGGATCGGA
AGATGTTGTCCACAGCCCAGCAGATGCTGCAGGATAGTCG
GACGAAAATCGAGCTGCTCCGCATGCAGATTGTCAAAGTC
ACACAGGCCAGAGAAGGAGAGAGAGAGACCACACAGCAAG
AAGGTCGCCCTTCTGAAACAATCAGTCCTCTCGAGCTGCG
GGTGGAGGAGCTCAGGCACCATCTAAGGATTGAGGCAGCT
GTGGCAGAAGGTGCCAAAAATGTGGTTAAGCAGCTTGGTG
TCCGTAAAGTGCAAGACCGACGTGCTCTAGCGGAAGCTCA
GGCCCGTTTGCAGGAATCCTCTCAAAAACTGGACCTGTTG
CGTTTGTCTCTGGAGCAGCAGCTTGGAGAACTTCCCCAAG
ACCATCCCAAACGAGCTGCCATTAAAGAAGAGCTGACAGT
AGGTTCCTCTCCTGGTATTGGGTTGCAAAGGGAACGCCTG
CGCTCTTCATCTTCAGCATCCTCTTCTCTCTTTAAACCAG
CCAGCCTGACAGGGCGATTGGAGGTCAGGTTGATGGGTTG
TCAGGACCTGCTGGAGTCAGTTCCAGGCCGCTGTCGTGTA
AGCAACATGTCCTCCGCTCCTGGAAGTCCATCTGACTCCA
AATCACTAAGAATGAGAACCGGCCTTTCCACTCGCAGCAC
CAACGGCAAGACCACCAAGACTGATGAACTGTCATCTGAA
ATCAGTGCTGTGTTGAAAGTGGATAACAAGATTGTTGGTC
GCACACATTGGCGGCCGCTGAGTAAGGATGCCTGGAACCA
AAGCTTTAGCATCGAACTGGAGCGGTCTCGAGAACTGGAG
ATTGCTGTGTATTGGCGAGACTGGAGGTCCCTGTGTGCCG
TGAAGTTCCTGCGTTTGGAAGACTTTCTAGACAACCAGAG
GCACGGCATGTGTCTTTATCTGGAGCCGCAGGGCACACTG
TTCACAGAGGTGAGATTCATCAATCCTGTCATTGAGCGGC
ATCCTAAACTACAACGACAGAAGAGGATTTTCCCTAAAGA
AAAAGGGAAGAATTTCTTACGGGCAGCACAGATGAATATG
AATTTCGCAACTTGGGGGCGTCTGATGATGAGTGTGTTAC
CCCCCTGTAACAGCACCATTACGGCCCTCAGCCCTCCGCT
GCCTGGCTCAGAGCCGCTGTCTCCTCCATCTGTGTCCACA
CCACCCTCCACAGGAGACTCAGCAGTTGTTAAACTGAATT
TCAGCGAGGAACGGCCCACCAAGCCTCCGCGCCTTCACTT
GGCGCAGAACCCTTCAGCTGATGAATCACTTTCTGGGACT
CCTGCCAGAGTAAACTCCACTGAGGACCGCCGAGTTCTCC
AAGCCAGGCCTGCGTCCCAGCCTACAACTCAGAGGCAAGA
AGGGATGCAGATGGAGGACTTTAACTGCATTTCTGTTTTA
GGAAGAGGGCACTTTGGAAAGGTCCTTCTGGCTGAATTCA
AGAGGACTGGGAAACTTTATGCCATCAAAGCCTTGAAAAA
AGGGGATGTTGTGACCCGGGATGAAGTGGACAGTTTAATG
TGTGAAAAGAGGATTTTTGAGACCATCAATGCGTCCCGAC
ATCCTTTCCTGGTGAACCTGTACGGCTGCTTCCAGACGCC
TGACCATGTGTGTTTTGTGATGGAATATTCTCCTGGAGGA
GACCTGATGACCCACATCCACAACAACATCTTCTCTGAAC
GCCAGGCCAGGTTTTATTCTGCTTGTGTATTACTGGGCCT
GGAGTTTCTGCACCAAAACCGGATTGTCTATAGGGATCTT
AAGCTGGATAATCTGTTAATGGACTCTGATGGCTTTGTGA
GAATTGCAGATTTTGGACTTTGCAAAGAAGGTATGGGATA
TGGAGATCGTACATCAACCTTTTGTGGCACCCCAGAGTTT
CTGGCTCCAGAGGTTTTGACAGACAGCAATTACACCCGTG
CAGTGGACTGGTGGGGTCTGGGTGTGCTCATCTATGAGAT
GCTCGTTGGAGAGTCTCCATTCCCTGGTGATGATGAAGAG
GAGGTGTTTGACAGCATAGTGAATGATGAAGTGCGCTACC
CCAGGTTTATGTCTCCAGAGTCAGTCTCCGTTATCCAAAA
GCTGCTGCAGAAGAACTCTGAAAAACGACTGGGGGCAGGA
GAGCAAGATGCCAACGAAGTCAAGAAACACCGTTTTTTCC
AGGGCATTGACTGGGAGGCTCTGCTGGCCAAAAGAGTCAA
ACCTCCATTCCTGCCGTCAATTAAAACAGCAGCGGACGTC
AGTAACTTTGACGAGGAGTTCACACGCCTCAAGCCTGTCC
TGACTCCTCCACAGACGCCGTTCTTCCTTAGCGCCGAGCA
GCAGGAGTTCTTTGCGGACTTCGACTTCTCTGCCCTGCAC
TGACT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pkn3-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030186 (1),  Ensembl_Trans:ENSDART00000112546 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK024349 (1) 762 nt
GenBank:AI584312 (1) 495 nt
CITATIONS (2)