Transcript

zdhhc12b-201

ID
ZDB-TSCRIPT-090929-12440
Name
zdhhc12b-201
Previous Names
  • zdhhc12-001
  • zdhhc12b-001
  • si:dkey-202g15.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030184 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030184|OTTDARG00000023203|ZDB-GENE-070705-356 zdhhc12b|OTTDARP00000024595 DKEY-202G15.2-001 LG_ CR387979.25 Danio rerio protein_coding NOVEL, 1490 bp
AGGAAACATGACATGTACCCGTCCTCACATCTAAGCTGCG
GAACGGCATCAACAAGCTTATTAGAGCGAAAGAAACACAG
AATACTGAAGTACCGCCGTTTCGGTTGAATCACAATGTTA
TAGCCGTCTCCATTAGGCGTGCAGCATACGAACCCCGACG
CCAGGGGACAAATATCCCGGTCAGAAATGGTTGTTGTTGT
GGAATTTAGCGCAGGACGCGTAGGAGCGCACTTGACAGCT
GGAATGTAACGTTAACTGGTTTCTGATGAGCTCGAGCAGG
CTAACAAACACAGCTAGCTGATGATTACAGCTCTTATGAC
AATGTGTTTCTTTGCGAGTGCACAGCAGACGCATGCTTAG
CAGGATATAGAAGTATGCTAGGATGTTCAAAAATGTGTTC
GGTTCAGGATTTCTGGTGAGGACCGCTCATGTCATTTTGA
CATGGGTTATAACGCTGATTCTCTTCCTACACGACACCGA
CCTGCGCCGGCAGGAGGAGACTGGGGAGCTCACACTGCCG
GTTCTCTTTGTGCTGCTGGTTCTGGTGTCTGTGTTGCTGT
ACTTTGCGGTCTCACTCATGGATCCTGGTTTTGTCCTGAC
TGATGACTGTGACTTGCAGTTCACACTTGGTATCGCAGAA
GAAACACAGGATATGATTCCACAGACCACCAAATCCATAC
GACTGCGGCGCTGTGGACACTGTCTGGTGCAGCAACCGAT
GAGATCGAAACACTGCCAGACGTGTCAGCACTGTGTGCGT
CGCTATGATCACCACTGCCCCTGGATCGAGAACTGCGTCG
GGGAGAGGAACCATCGCTGGTTTGTGCTTTATCTGGCCGT
CCAGTTTGTGGTCTTGCTGTGGGGACTGTACATGGCTTGG
TCAGGCTTCAGTCACGCCTCCACCTGGCAGCAGTGGTTGA
GGACTAACGGTGTTCTCCTGGGAGCAGCAGCAGTGGTTGC
CATTTTGGCCCTCACCGTGCTCCTCCTCCTGGGCTCGCAC
CTCTACCTGGTGTCCTTAAACACCACCACATGGGAGTTCA
TGTCCCGACACAGAATCTCATACCTCAAGCACTGCGGTGC
AGACGAAAACCCTTTTGACAAAGGAATCCTGCGCAATCTC
TGGGGCTTCTTCTGCGCTTGGGAACCGGTGGTTTGGGAGC
ACGTTTACTTCAAGCAGGGCAATGATCCCATTTGATTCCC
TGGGTGTCGTGATGTCCCTGACGTATAACCAATAAGACGG
AAGTTGATATTTTATTAGCGGGAAACTTCTTTAAACTTTG
CAGGACGTCTACTTCGGTTTCCTTGTGAATGATCCATTTG
GAAAGTGTTTCTTAAATGCATGAACTTTGTAGTTGCGATG
ATGTGATGATCAAGTGTTATCAAATGATGAGTGTTTTTAT
AAAAGGTGTTTTGCGAATTCTTTACCAGTACTTTGACAAT
TGTGCTGATTTTTGCACATTTTTAAAGCAAACACAGAACA
AAAAGCACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations