ZFIN ID: ZDB-TSCRIPT-090929-12427
Transcript Name: si:dkey-172o19.2-201
Previous Name: si:dkey-172o19.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030169 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030169|OTTDARG00000023195|ZDB-GENE-070424-213 si:dkey-172o19.2|OTTDARP00000024579 DKEY-172O19.2-001 LG_ BX088720.8 Danio rerio protein_coding NOVEL, 796 bp
GCCTCTAGCAGACGCTTGTCTTCCTTCCTCCACTGGTGAG
ATCTCAGTCAGCAAAGACGAACCCGGAAATCTAAGGAGGC
GTCTTCCGCTCACCGGCTCGTCCACACTGGCAAGGCGACT
CTTCCACTTCCAGTCATACCGTAATCCACTCATTACCAGC
AGACGGCGTAAACGTGAGATGACCCCCTCAGAGAAAAAAG
ACGCGTCATATTGGGTCAAGCGAAAGAAGAACAACGAGGC
TGCCAAACGGTCCAGAGAGAAGCGTCGACTCAATGACTTC
ATGCTGGAGGGACAGCTTCTGGCGCTGAGCGAAGAGAATG
CCCAGCTCAGGGCTGAGGTGCTGAGTCTGCAGTATCACAT
GGGAATCGCACGAAGTCTGGATGTCAATCATCCCATCATG
CCCTTTCCCTATCCTGTTATGTCCCATCTCAAGCCTTCCC
TGTGGGGTTTGGCTACCAGTGCTGCTCCTCTTCCAGCTGA
AGTCCCAGATCTGTACTCCTCTTGGTCACAGCACAGCTCA
TCTCCATTCATCTCGCCCTTGAGGGTGCCTCCTAAAAGTG
CAAACCTACCTTCACAGGTTGGCCATTTGGACAACATTGT
TGACCCAGTAGAGGCGAATCCAGCATCTCACCCACAGGTC
TCTTCAAGCAACGACCCACCGAGCCACCCACAATTGTTTC
CTGCCCAAAAAGCATCTGCGGCTTCACCGCCCCCTCCCCA
GTTGTTACCAGGCCTGAGCCACTCTGCCAGCCAGAACAAC
AGCCAGATGTTACCCTGGGGCTCGTCGTCTTTGCGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-172o19.2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030169 (1),  Ensembl_Trans:ENSDART00000141852 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL928045 (1) 524 nt
CITATIONS (2)