Transcript

nfil3-4-201

ID
ZDB-TSCRIPT-090929-12426
Name
nfil3-4-201
Previous Names
  • nfil3-4-001
  • si:dkey-172o19.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030168 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030168|OTTDARG00000023194|ZDB-GENE-070424-214 nfil3-4|OTTDARP00000024578 DKEY-172O19.3-001 LG_ BX088720.8 Danio rerio protein_coding NOVEL, 747 bp
ATGGAGTCTGCTTTCTCACAAATGAGGTGGGACCATGAGG
GAGAGTCTGAAGAAATGTCTCTGCGTGCTTTGGGATTGCG
CCGCAAACGGGAATTCATTCCCGAGGACAAGAAAGATGCC
ATGTACTGGGAGAAACGCCGCAAGAACAATGAAGCGGCAA
AGCGCTCGAGGGAGAAACGAAGGGTCAGTGACTACATGTT
AGAGACTCGATTGGTTTCTCTGAGTGAGGAAAATGCTCGT
CTACGAGCCGAGCTGTTGGCACTGAGGCTTCGGTGTGGAA
TGCTCAACCCTGGAACCCCCTACTCTTCATCTCAAAGCGC
TCTATCTCAGCTTCACGCCTTGGCGCCACAACCTCTGGTT
TCCTGCCCAGATAAAGACCTCTCTTGGGGTAGAAGACAAG
ACAGAGAGACTTCCAATCTGTCAGGGATCCAAAAGTCACC
CATCTGTCTAGGTACTCATCCAGGATCAGCATTCCTGCCC
ACACACCCAATGGCCATAAGAAGAAATCACCCCTATTTAC
TAGAATTCCCAAGTGTCCATTCTCCTACAGCCACACCTTT
ACTCTTTCCTCCGCAACTCAGCCCACCAACCACCACATGG
GCAGGACGACCCTTGCTTCAGCCTGGGAATCACAGGATCT
TGTCAGATGAGGAGGGTGAGCAGCAGGTACCAGCAGATTC
CAGTTCTGCACTGCCCCACAAACTGAGACTGAAGACGCAA
ACCTCACAGTTCAAGGACAATGGAGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations