ZFIN ID: ZDB-TSCRIPT-090929-12426
Transcript Name: nfil3-4-201
Previous Names: nfil3-4-001, si:dkey-172o19.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030168 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030168|OTTDARG00000023194|ZDB-GENE-070424-214 nfil3-4|OTTDARP00000024578 DKEY-172O19.3-001 LG_ BX088720.8 Danio rerio protein_coding NOVEL, 747 bp
ATGGAGTCTGCTTTCTCACAAATGAGGTGGGACCATGAGG
GAGAGTCTGAAGAAATGTCTCTGCGTGCTTTGGGATTGCG
CCGCAAACGGGAATTCATTCCCGAGGACAAGAAAGATGCC
ATGTACTGGGAGAAACGCCGCAAGAACAATGAAGCGGCAA
AGCGCTCGAGGGAGAAACGAAGGGTCAGTGACTACATGTT
AGAGACTCGATTGGTTTCTCTGAGTGAGGAAAATGCTCGT
CTACGAGCCGAGCTGTTGGCACTGAGGCTTCGGTGTGGAA
TGCTCAACCCTGGAACCCCCTACTCTTCATCTCAAAGCGC
TCTATCTCAGCTTCACGCCTTGGCGCCACAACCTCTGGTT
TCCTGCCCAGATAAAGACCTCTCTTGGGGTAGAAGACAAG
ACAGAGAGACTTCCAATCTGTCAGGGATCCAAAAGTCACC
CATCTGTCTAGGTACTCATCCAGGATCAGCATTCCTGCCC
ACACACCCAATGGCCATAAGAAGAAATCACCCCTATTTAC
TAGAATTCCCAAGTGTCCATTCTCCTACAGCCACACCTTT
ACTCTTTCCTCCGCAACTCAGCCCACCAACCACCACATGG
GCAGGACGACCCTTGCTTCAGCCTGGGAATCACAGGATCT
TGTCAGATGAGGAGGGTGAGCAGCAGGTACCAGCAGATTC
CAGTTCTGCACTGCCCCACAAACTGAGACTGAAGACGCAA
ACCTCACAGTTCAAGGACAATGGAGCC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nfil3-4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030168 (1),  Ensembl_Trans:ENSDART00000135490 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)