Transcript

gdap1l1-201

ID
ZDB-TSCRIPT-090929-12418
Name
gdap1l1-201
Previous Names
  • gdap1l1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030160 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030160|OTTDARG00000023189|ZDB-GENE-080812-2 gdap1l1|OTTDARP00000024571 DKEY-18F23.7-001 LG_ BX465853.12 Danio rerio protein_coding NOVEL, 1104 bp
ATGGCGTCTTCCAACAATGTTACTCCCACCAACTGTAGCT
GGTGGCCCATTTCAGCCATGGAGGAAGATGGCAAAATCCC
AGACGGAGAGGAGAGTCACGAGCCCACGATACACGAACAC
AAGCCATACTCCAAAGACAGGCTCGTGCTGTACCACTGGA
CTCAGTCCTTCAGCTCGCAGAAGGTGCGTCTGGTGATCAA
CGAGAAAGGGCTTTTGTGTGAAGAGCGGGACGTCAGTCTG
CCTCTCACTGAGCAAAAGGAGCCTTGGTTCATGAGGCTTA
ATCTAGGAGAGGAAGTGCCAGTGTTCATCCACGGAGACAC
CATCGTCAGTGACTACAACCAAATCATAGACTATATAGAG
ACCAACTTTGTAGGAGACACAGTAGCCCAGCTAATTCCAG
ATGAAGGCACTCCCATGTATGCAAGAGTCCAGCAGTACCG
AGAGCTGCTGGATGGACTGCCCATGGATGCTTACACACAT
GGATGCATTCTTCATCCTGAACTCACAACCGACTCCATGA
TCCCAAAGTACGCCACTGCTGAAATACGTAGACATTTGGC
CAATGCAGCGTCTGAACTGATGAAGTTGGACCACGAGGAG
CCTCAGCTGACAGAACCATACCTCTCCAAGCAGAAAAAGC
TCATGGCAAAGATCTTGGACCACGATAATGTGAACTACCT
GAAAAAAATTCTTGGAGAGTTGGCGATGGTACTAGACCAA
GTAGAGGCAGAGCTGGAAAAAAGAAAACTGGAATATCAAG
GTCAAAAGTGTGAATTATGGCTTTGTGGACCTACTTTTAC
ACTAGCTGATATTTGTCTTGGAGCCACGTTGCACAGGCTC
AAGTTCTTGGGACTCTCGAGGAAATATTGGGAGGATGGGA
GCCGGCCAAACCTGCAGTCGTTTTTTGAGCGGGTGCAGAA
GCGTTACGCCTTCCGCAAGGTATTGGGGGACATCCACACC
ACCCTGCTTTCGGCAGTTCTACCCAATGCTTTCCGAATGG
TAAAAAAGAAGCCGCCATCCTTTTTCGGGGCATCCTTCCT
AATGGGCTCTCTCGGAGGGATGGGCTATTTTGCCTATTGG
TTTTTAAAAAAGAAATACATGTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations