ZFIN ID: ZDB-TSCRIPT-090929-12418
Transcript Name: gdap1l1-201
Previous Name: gdap1l1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030160 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030160|OTTDARG00000023189|ZDB-GENE-080812-2 gdap1l1|OTTDARP00000024571 DKEY-18F23.7-001 LG_ BX465853.12 Danio rerio protein_coding NOVEL, 1104 bp
ATGGCGTCTTCCAACAATGTTACTCCCACCAACTGTAGCT
GGTGGCCCATTTCAGCCATGGAGGAAGATGGCAAAATCCC
AGACGGAGAGGAGAGTCACGAGCCCACGATACACGAACAC
AAGCCATACTCCAAAGACAGGCTCGTGCTGTACCACTGGA
CTCAGTCCTTCAGCTCGCAGAAGGTGCGTCTGGTGATCAA
CGAGAAAGGGCTTTTGTGTGAAGAGCGGGACGTCAGTCTG
CCTCTCACTGAGCAAAAGGAGCCTTGGTTCATGAGGCTTA
ATCTAGGAGAGGAAGTGCCAGTGTTCATCCACGGAGACAC
CATCGTCAGTGACTACAACCAAATCATAGACTATATAGAG
ACCAACTTTGTAGGAGACACAGTAGCCCAGCTAATTCCAG
ATGAAGGCACTCCCATGTATGCAAGAGTCCAGCAGTACCG
AGAGCTGCTGGATGGACTGCCCATGGATGCTTACACACAT
GGATGCATTCTTCATCCTGAACTCACAACCGACTCCATGA
TCCCAAAGTACGCCACTGCTGAAATACGTAGACATTTGGC
CAATGCAGCGTCTGAACTGATGAAGTTGGACCACGAGGAG
CCTCAGCTGACAGAACCATACCTCTCCAAGCAGAAAAAGC
TCATGGCAAAGATCTTGGACCACGATAATGTGAACTACCT
GAAAAAAATTCTTGGAGAGTTGGCGATGGTACTAGACCAA
GTAGAGGCAGAGCTGGAAAAAAGAAAACTGGAATATCAAG
GTCAAAAGTGTGAATTATGGCTTTGTGGACCTACTTTTAC
ACTAGCTGATATTTGTCTTGGAGCCACGTTGCACAGGCTC
AAGTTCTTGGGACTCTCGAGGAAATATTGGGAGGATGGGA
GCCGGCCAAACCTGCAGTCGTTTTTTGAGCGGGTGCAGAA
GCGTTACGCCTTCCGCAAGGTATTGGGGGACATCCACACC
ACCCTGCTTTCGGCAGTTCTACCCAATGCTTTCCGAATGG
TAAAAAAGAAGCCGCCATCCTTTTTCGGGGCATCCTTCCT
AATGGGCTCTCTCGGAGGGATGGGCTATTTTGCCTATTGG
TTTTTAAAAAAGAAATACATGTAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gdap1l1-201 Contained in:
[BAC] DKEY-18F23 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000030160 (1),  Ensembl_Trans:ENSDART00000047082 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL926317 (1) 486 nt
CITATIONS (2)