header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12387
Transcript Name: tmem232-201
Previous Names: tmem232-001, si:dkey-264m17.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030127 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030127|OTTDARG00000023168|ZDB-GENE-070705-434 tmem232|OTTDARP00000024545 DKEY-264M17.1-001 LG_ CT027545.4 Danio rerio protein_coding NOVEL, 1974 bp
GCTTTTTTATCAACGTACAGTGTCTGGTTGACTGCTGAAT
GTATCAGTATGCCTATACTCAAAATTCCTATTAAACATCA
TTTAGGAATAGTTTCTCAATCTCAACTCGAACAATTAATA
AAACGCCACAGAAAAAAGAAAGAAGAAACTGGAAATGTTA
CTGCAAGAAAAAAAATCAAAAGAAATCCCCTTGAAACAAC
AGAAGACTTTATTGAAAAATACAATCAAGTACAAGGTAGC
AAGGAGCAGGAAAAGTATGAAAACCTTGCAAAAGAATTCC
TTTGTCGATGGAAGCGCCTTGCAGGATTCACAGCTGCTGC
TGGTAAAGGCAAACATGTTGATCTCCCTAGGGCCTGGACA
CAGCTTGTCCTGCTGAGCCTGAGCAATGGAAACGTTAGAA
ATGATTCACTAAATGCCCTGGTGGTGTCATTGGATCATGC
ACCCTTTAACGCAGATCAGATCCCTGTGCTCTTCCACCTG
GTAGAATCAGTCCAGCATTTCCTTTGCTCAAACACAACTC
TGTCAGAACAGCCATGTTCATATGAGAAGAAGATGCTGCA
GCTTGGTTATTTGGTGTCTTTGAGGCTGTTCATCTTTCAA
CTGACTGGTATGAATGAACAAGAGCTTAGCAACATATATC
TACAGAGGTTAAAAGAGCTGTTGACGTGTGAGACACGCTA
CCAAGAGTTCCCCGACATGTTATTTGCTGTTCAGTTGATG
CTGTGCGTCTGGGAGGTTCTGTGTGGTCTCAGACTTACAG
AGGATAATGCAGCGCAGGTCTCTGTAGAAGCACGAGAGCT
GGGTGTTAACCAGGTCTTACGGCAGTGCCTTCTCAGCTAT
CACTGTGTGCAAAACAATGGCACTCAGCTCCCTCAAGTGA
TCAAACAGCTTATGTTGCTGAGAGATAAGCTTCAGCATGA
CAACTGGGTCGAGTGTGGGTTAGGACTGATGATTCTAGGA
GAGGCTGCCAAATCTAGTATGCTGTGCCTTCAAGCACTTA
TGAATCTTCACATGACTCAAAGACAGGAAACGGAATCACA
GACAGCATCCTGGCCTTGGCAATTGGAGCACATATATTGC
TCCATTTTGATCAACATTTGCCAGAACAGCCACTGTACTG
AAATTAGGAAAACCGCATTAAATGGAAAGTCAATCTCTTC
TACTCGCAGATGTTCTGGAGGACTTATAACCTTACTAAAA
CAACTGCATGAAGACAAATGGAGGCTGAGGTATACTGTGA
TTCAGGGTTTGGTTCAGATTAGCCAGAAAATCACTCTTCA
GGAAGATCTGAGGAATACGGCTTGGTCAGCACTACAGAAA
CATCTGAACCAGGAGACAAAGCCCTGCGTCATTAATGCTG
CAACAATCATTGAGGGTGATAAAAGGCTCCTGGAGAAGCA
CAGGGAGAGGATAAGGAGTTCACGCACAGATAATGCATGT
GTATGTGCAGTGAGCGAACAGATTACTAGGCGTTTGGCAC
ATGCTCTTTCCAAGATCTGCCCTCCAGTTCAGTTGAGTGC
TTGTTCTGCAGACCACCGGCACAGAGTAAAACCTTCCCAA
CTCACCGCCTGGGCTGGAAGAAGACAGACAGAGCCAAACA
CACCCCACATCTTCACTAAAGACACCTTCAAGACACCAAG
ACATGGTCAACGGGGAGCTTTTCATATGGACCTTAGAACC
AGGACTGACCTCGATCTGATTAAAGTTGTGGAAGATCAAT
GGCAAAAAGAATTGAAAATAAGGGAAAGAGAGGAAGAGAT
GGAAAAGACGGAGCTGGAATTGAGAAAAGAAGAGGAAGAG
GAGAAGATCATACAGAAGCGTATGGAAAAGGTCAAAAAGA
ACACAAAACCTTATGAGTTACAATGAATCAACAGGGATTT
ACTGCAAAGAATTGTTTTAAAAACAATCATAACCATATAG
TAGCTCATCAGAGACATTTCATTAATGAGTTTATTAAAAA
AAATGATGAATGTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem232-201 Contained in:

OTHER tmem232-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030127 (1)
  • Ensembl_Trans:ENSDART00000097409 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC128881 (1) 1980bp
    GenBank:CD759277 (1) 845bp
    GenBank:EB928435 (1) 721bp
    GenBank:EB973746 (1) 544bp
    GenBank:EB935405 (1) 409bp
    CITATIONS (2)