Transcript

cwc15-201

ID
ZDB-TSCRIPT-090929-12383
Name
cwc15-201
Previous Names
  • cwc15-001
  • zgc:86607-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030123 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030123|OTTDARG00000023167|ZDB-GENE-040625-10 cwc15|OTTDARP00000024544 DKEYP-20G2.7-001 LG_ CR926467.10 Danio rerio protein_coding KNOWN, 1114 bp
GTTCCTCTGCGACTACCGTAACGTACGCGCACGTGATGTT
GTGTGCGTGTCGCGGTGGCTGATGGGATATCCGCGAGGGG
CAACAACATCCGAGCTAATCTCGAAAAAGCTGTAAAATTG
GCGTTATTTATTTAGTCGTTTGTGGTTAGAACAATAAATT
TTCGCCTTGATACGTTTTAAGGCGTACGGGGGGATTTATT
TACTCCTACTGCAGGTAACCGAAGATGACAACTGCAGCAA
GGCCAACGTTTGAGCCCGCACGAGGAGGACGGGGCAAAGG
AGAGGGTGACCTGAGTGCTCTGTCCAAACAGTACTCCAGC
AGGGACCTGCCAGGACACACAAAGATCAAATACAGGCAGC
CCACTCAGGATGCTCCCGAGGAGGTGAGAGCCCGTGATTT
CAGGCGCGAACTGGAGGAGAGAGAGAGAGCTGCTGTCAAG
GGCAGAGACAGAGGAGCGAGAGAACACACAACTTCCTCGT
CTTCATCTTCTTCATCCTCCTCATCCAAGCGGCCACGTCT
GGATCAGATTCCTGCTGCTAATCTGGATGCAGATGATCCC
CTCACTGATGATGAAGACGACTCTGGCTCCGATTCTGACA
GTGATGATGATACTGCCGCCCTCCTGGCCGAACTGGAGAA
GATCAAAAAGGAGCGAGCTGAGGAGCAGGAGAGGAAGGAA
AGGGAACAGAAGGCAGAAGAAGAGAGGATACGTATGGAGA
ATATTCTGAGTGGGAATCCTCTGCTTAATCTGGCTGGCCA
ACAGCAGCAGCAGCAGCAGCAACAACAACAGCAAACACAA
ACCAAGAACACGTTCAGCGTGAAGAGAAGGTGGGATGATG
ACGTTGTGTTTAAGAACTGTGCTAAAGGAGTGGATGAATC
TCGAAAAGAGAAGCGCTTTGTTAACGACACCCTGCGCTCT
GAATTCCACAAGAAATTCATGGAGAAATATGTTAAATAAA
AGATTTCCTGTGTTGGAATTGTATTTCGGCCACTTTTAAG
AACTTTTTTGTTTCCTCTTTAGTAAATATGTGTGCTTCCT
TTTAAAATGTTGTCCTTCTGTTCTGCCGTTAATTAGTTTA
ATTGGAAATAGTACCAATAAATGGAATTAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations