Transcript

dhrs11a-201

ID
ZDB-TSCRIPT-090929-12223
Name
dhrs11a-201
Previous Names
  • dhrs11a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029851 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029851|OTTDARG00000022985|ZDB-GENE-060929-324 dhrs11a|OTTDARP00000024350 CH211-286F15.2-001 LG_ CR388162.28 Danio rerio protein_coding KNOWN, 1791 bp
GTTCACTGAATCACAGATATGACTAAACGGCGACACTGAC
ACAAACTAACCGCCGCTCGTGCAGGAGTTTGATACATTGT
TTCATCCCGCCGCGGATTCTAGTTTTTAGTTTGATACATT
GTTTCATTACGTCTGCGGATTCGATTCTTTGAGACAGTGT
TCCATTCGAATCCGAATTCTTTTTGATACATTGTTTCATC
CCGCCGTGGATTGGAATTATTTTTTGATCAATTTTACTAT
TTCGCCGCGGATTCGATTTGTTTGATACATTGTGTCATTC
CGGCGCGAATTGGAACTCTTGTTACATTGTCATCACGCCT
GCAGTGATTGTGTTCCTGTGATGATAATGATGGAGCGCTG
GAAGGGGAGAGTCGCGCTGGTTACCGGAGCTTCTGTCGGT
ATAGGAGCGGCTGTGGCTCGCGCTCTGGTCCAGCACGGGA
TGAAGGTGGTCGGGTGCGCTCGGAACGTGGACAAAATCGA
GAAGTTGGCGGCGGAGTGTCAGAGCGCAGGGTACAGCGGT
ATCCTCATCCCGTATAAGTGTGATCTGTGCAATGAAGAAG
AGATTCTGTCCATGTTTTCCGCCATTAAGACGCTTCATCA
GGGAGTGGACGTGTGCATCAATAACGCCGGTCTGGCACAC
AATGAGCCTCTGCTCAGCGGACGGACAGACGGCTGGAGGA
ATATGATTGATGTGAACATTCTGGCACTGGCCATCTGCAC
ACGGGAGGCCTATCAGTCCATGAGAGAGAGACATGTAGAC
GACGGACACATCATCAACATCAACAGTATGGGTGGACACA
GGATGGTGTCCAGCGCTGATGAACACTTCTACTGTGCCAC
TAAATATGCCGTGACTGCAATGACAGAAGGACTGAGACAA
GAGCTGCGGGAGGCCAAAACACACATCAGAGCCACGTGTA
TATCACCTGGAATAGTGGAGACTGAGTTTGCTTTTCGGCA
TCATAACAGCGATCCGGAGAGAGCCGCGGCTGTTTATGAA
AGTATAAAGTGTTTGAAAGCTGAAGACATCGCCAGCGCCG
TCACATACGTGCTGAGCGCTCCTGCGCATGTTCAAATCGG
TGATGTGCAGATGCGGCCGGTCGACCAAGTGTCGTAGGAT
TAACATGAGGGACACCTGCTGGCTAAAACACGTGTAACAA
CTAGATTTAAAGAACTGATTGAAGGGAATTTTGTTTGCAG
ATCAGATCAGATCAGATCAAAAGTGTGAAGGACGCAGTGA
TCTGACGCCATGCTCGGGCCGGAGAGCACGGGTTTACCTC
CGTTTAACATTACCGTCTCTGCTGCTGTCTCAGATTTAAC
AGGAAAGTCTCTCTGCATTGTTAAAAACACACTACAAACT
GGAAGACGTGATGATGTGTGTTTGACAGCCTATGCAGAGA
TGAACTGCACATTATTTTGGCCTTTTTTTTTTTTTTTAGG
TCATATTGCATAGGGGTCTGTTGAAGAGTGTGACGGGAAG
TCCATTGTTGCCGGTAGTATGGAGCTAACTATGTGACAAA
ACTATTTGAATTTTATGAAGTCGAATTGGTGACAAAAATA
TTTTTTAGTAAACAAGTACAGTTCATATATAAGTACACCC
ATCACAAATCTATATTTTAGGTTAATGGTTATGCTATAGA
ATATTATATTTGGGCATATTAGATTAGATAGAATTGGATT
ATTCATCAATGAAGCCAAATCTGTAGATAATCTAACAAAA
TAACTGTACTGTACACTCAAATGTATATGTTAGGGAAAAA
TATTTGATAAAAATTCAACAACAAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations