Transcript

kcnd2-201

ID
ZDB-TSCRIPT-090929-1220
Name
kcnd2-201
Previous Names
  • kcnd2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000008511 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000008511|OTTDARG00000007538|ZDB-GENE-041210-70 kcnd2|OTTDARP00000007353 kcnd2-001 LG_none AL929168.3,AL929016.5 Danio rerio protein_coding NOVEL, 3426 bp
CGCAGACTCACAGATCTCCGTCGGTAGCGGATGAAGCAAC
TTCCAGCAAATCATTTGTTGCAGGTTCAGTTTTTGTTCTG
GTTACAGACAGACCCTGCCAAATTGTTCACGGGACGCTGG
ATTACATTTCAAGGAAGCGGATAGGAAAGTGGCATTTGCT
TTTTTTGAAACACCGAACGCGCACTCGCCAGGGTGGTCTT
CTCTCCCTATGAAAGGACCACTGTGGCAGGTTTTCTCTAT
AAGCGGTAGTGTGAAGCACATATCAGCTGTGACTGGCTAA
AAGGATGTCCTTGGACAACGCGAATCCTCTACCTGACTTG
TAAACTTGTTGCATTTGCTCCAGAACACCTCCGAGAGCGC
ATTTTGGATACTTATTTGCGCGTAACGACGGAACAGCGAT
ACAAAGTGGACTATAACTGATGAACTGTGTGTAAAAAGCT
GCACTTTTGCATCAAAATCCATTTATGAGGAGATGTCCTT
TCTGCGCGTGGCGGATCAGTGAGCGCAAAATCTGCTTCAG
TCGCACCGGTTCGCGCACATTGGGTCAGGATGGCAGCCGG
AGTCGCCGCGTGGCTACCGTTCGCGCGCGCCGCAGCTATA
GGATGGATGCCCGTGGCGAGCGCCCCGATGCCGCCGCCTC
CGCGGGACAAGAAGCGTGGTCAGGACGGGTTGATCATCTT
GAACGTCAGCGGCACTAGGTTTCAAACTTGGCGGAATACT
TTGGAGAGGTACCCTGACACCTTACTGGGGAGCACAGAGC
GCGACTTTTTCTTCCACGAGGAGACCAACGAGTACTTTTT
CGACCGCGACCCGGACATCTTCAGGCACATTCTCAACTTC
TACCGCACCGGGAAGCTGCACTACCCTCGCCACGAGTGCA
TCTCCGCCTATGACGAGGAGCTGGCCTTCTTCGGCATCAT
TCCAGAGATAATAGGTGACTGCTGTTATGAGGAATACAAA
GATCGCAGAAGGGAGAACGCGGAGAGAATTCAAGACGATG
AGGAGAACGACAACAACAACGACTTGGTCATGCCGGATTT
GTCGTTCCGCGAGTCCATGTGGCGCGCGTTCGAGAACCCG
CACACCAGCACCATGGCGCTGGTCTTCTATTACGTCACGG
GCTTTTTCATCGCCGTCTCCGTTATGGCCAACGTGGTGGA
GACGGTCCCGTGCGGCATCTCGCTAAACCGCGCGAAGGAG
CTCTCGTGCGGGGAGCGCTACGCCCTCGCGTTCTTCTGTT
TGGATACGGCCTGCGTCATGATCTTTACCGTCGAGTACCT
GCTGCGTCTGATCGCCGCACCCAGCAGGTACAAGTTCGTC
AAAAGCGTCATGAGCATCATCGACGTGGTGGCAATCATGC
CTTACTACATCGGCCTGGTCATGACGGACAACGAGGACGT
GAGCGGGGCCTTCGTCACCCTCAGGGTCTTCAGGGTCTTT
CGGATTTTCAAATTTTCGCGGCACTCCGCGGGGCTGCGCA
TCCTGGGCTACACGCTGAAGAGCTGCGCGTCCGAGCTGGG
CTTCCTGCTCTTCTCGCTCACCATGGCCATCATCATCTTC
GCCACCGTCATGTTCTACGCAGAGAAAGGCTCCTCTGCCA
GCAAGTTCACCAGCATCCCGGCGGCTTTCTGGTACACCAT
CGTCACCATGACAACGCTGGGATATGGAGACATGGTTCCT
AAGACCATCATGGGGAAGATCTTTGGCTCTATTTGCTCTC
TGAGTGGCGTGTTGGTGATCGCTCTTCCCGTTCCTGTCAT
CGTGTCCAACTTCAGCCGGATCTACCATCAAAGTCAGCGT
GCAGAGAAGAGACGTGCCCAAAAGAAAACCAGGCTTGCTA
GAATTCGTGCGGCGAAGAGCGGCGGCGCTAACGCTTATTT
GCAGTACAAACGCAATGGGATGCTGGTGGACATGGAGGAG
GAGGCATCCAAAGAGGCGGGACAAGCTTTGGTATGTAAGG
CCAACCCCACATTTGAAACCCAACATCACCATCTCCTGCA
CTGCTTGGAGAAAACCACGAATCATGAGTTTGTGGACGAG
CAAACCTATGAGACGAGCTGCATGGAGGTTTCTCTTGCGA
AGCCATCTATGTCCCGTTCCTCATCGATGTCCTCCTCTCC
TCATGGCCTGTCCTCCTGCTGCACGCGCAGAAATAAGCGC
AAGAGCTTCAACGTCCCCAATTCCAACATGGCCGGCGGCC
GCAGGGGCAGCATACAGGAGCTCAGCACCATCCAGATCAG
AGAGAGACCGCTGAGCAACAGCCGCTCCAGTCTCAATGCC
AAGTTTGAGGAGACGGTACCGCTGAATTCAGAAGAGCCGT
CCTACATCACTGCGGCGGTCATCAGCATGCCGACTCCACC
GGTTACTACACCCGAGGGTGTAGACTTGGCCAGCTCGCAC
GACTTCTTGCAGAGCAACATTGTCAGGGTGTCGGCGTTAT
AGACCGTCCATTAGCCGTTTGAGTATATGAGTAAACACTG
GATCGACGGATCGCCCCCTAGTGTAGTGGAGGAGGCATTG
CAGCAGGATGGGCCTCAGCTGGACCTGTTTTTTTTTTATT
TGTTTGTTTGTTTTTTGAATCAGCTCCCATCCAGAGCTCT
CCGTCAGCTCCACCTCCAGGTCATGTGACTCCCACCGGGG
TTCAATAGGCTTAACCCATAGAGAAAAACAATGCCCATTG
TGGTTGTTTCATTTTTTCAGTATTGTGTGTCGCTGAATTT
GTCGTCTTCGATTTTGATGGGATCGCGTGATATATTTAAG
GAGTGTACCAGCAGGGGCGGGATTTTACAAGCTTTTAGAC
AGCTCCACACACACTTTTGATACTACAAAGTAAAGCTGGG
CTCTACTAAGGTGTGTGTTTGAATGCGCGCGTGCGTGTAT
GAGTGTATACAATTAAAAATGATCTCTTGCATGTTTTTTT
TTTTCACGTAAGTCTTTGTCTTTTCGGCATGAGCAATAAG
GATTGGCTCTTTCTGTCAGAATGCGTGTTTTAATTGTTAA
TAATTTGCCTAGTTATATATACGATATCGATCTTTCGAAA
CTCAGCGAGTGTGTGGGTAAAAAAAAAAGCTGTTTTGTTG
CTTTCCGAGAGTTTGGCCTGTTCATCTTCTCTCTCTGTCC
CACCCATGTTGTGTTCACTCCTTGCCTGGCCTGATGGGAT
GTTCGTTATTCTTCTTTATTTGTGGATGAGTACAAAGAAA
AGCTGAACAAACTTTCTTTTCCTAAATGTTTCAGCATATT
TCTGGAGGCTTGTGGACTTGAGCTCAAATACTAGCCATTC
CGTTTTATACTCCAAAGTTAGCGAGTTAACTGTGAAAAAG
AAAAAAATAATGTGCTTATTTATTATCTTTGTTCAAATTC
TTGTGCATGTTGTCGTGGACATGGTGAAACAGGCCAGTAT
GGACCAGAGCTATATTTATTTTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations