Transcript

slc37a4a-201

ID
ZDB-TSCRIPT-090929-12183
Name
slc37a4a-201
Previous Names
  • slc37a4-001
  • slc37a4a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029803 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029803|OTTDARG00000022952|ZDB-GENE-040426-2230 slc37a4a|OTTDARP00000024318 slc37a4a-001 LG_ BX927291.8 Danio rerio protein_coding KNOWN, 1927 bp
GTTTTACAGATCTGCACGCAAGAGTTCAGAGCCCTCAGAT
GTTCCTGCTAACCCGCTAACAAAGAACACCTTCATTGTTG
CTTATTTTAGCCATGGCGAAGACTGGATATGGCTACTACC
GGGCGACTATATTCCTGGCCATGTTTGTGGGCTACACGCT
GTATTACTTCAACAGGAAGACGTTCTCCTTCGTGATGCCG
TCTGTAATGCAGGAGATCACACTGGATAAGGATGATCTGG
GTCTCATCACCAGCAGTCAATCTCTGGCCTACGCCATCAG
CAAGTTCATAAGCGGTGTGCTGTCTGATCAGATGAGCGCA
CGATGGCTCTTCTCTATTGGGCTGTTTACAGTCGGCGGCA
TTAATGTCATTTTCTCTCAGTCGTCTTCGGTGGCTGTCTT
CTCAGGCCTGTGGTTTCTTAATGGACTAGGTCAAGGTCTA
GGATGGCCACCTTGTGCAAAAGTGCTACGTAAGTGGTTCG
AACCATCTCAATTTGGCACCTGGTGGGCAGTGCTGTCCTG
CAGTATGAATCTGGCTGGAGGTCTCGGACCCATAATTGCA
ACTCTGATGGCTCAAAGCTACAGCTGGAGGTCCACGCTGT
CCATCTCTGGCTTGACCTGCGTGGTCACGTCAATCTTCTG
TCTGATCATTATCCGAAATGAGCCCAGTGAAGTTGGCCTG
CCAAATATTGAAGCTGGAGCCAAGAAAGTCAAAGGAGGCT
CCAGCAAAAATGAAAGCACCTTCAAAGAGTTCATCTTTTC
TCCATATCTATGGCTGATGTCGCTGGGGTACCTGGTGGTG
TTTGGGGTGAAGACTGCCTACACAGACTGGGGGCAACTTT
TTCTCATCCAGGATAAGGGGCAGTCGGCTCTAATGGGCAG
TTCCTTCATGAGTGCCCTTGAAATCGGAGGACTGCTGGGT
AGTTTAGCTGCAGGATTCCTGTCAGACAGAGCCGTGGCAA
AGCATGGATTGCGATTGTATGGTAACCCTCGGCATGGGCT
CTTGCTCTCCATGATGGCTGGGATGTTTGTGTCCATGTAC
CTCTTCCGCACAACTGTCACGGCACACAGCTCAAACGTCT
GGATTCTCTTGTTGGGTGCTGCTTTTGGCTTTTCCTCCTA
TGGACCGATTGCCTTGTTTGGAGTTCTTGCGAATGAAAGC
GCTCCGTCAAACTACTGCGGGACTTCTCACGCCATTGTCG
CACTAATGGCAAATGTTGGTGGTTTTCTGTCAGGCTTGCC
ATTCGGAACCGTTGCTAAACACCACGGCTGGAACACAGCA
TTCTGGGTAGCAGAAATAGCCTGCATGGTCACAACAGTTG
GATACTTCCTGCTCCGAAATATACGCACCAAGATGGGAAG
CATTCCCAAGAAGGCAGACTAGACATTAGAGTGTTATTTA
AATATATTTGAACTAGTTTCTAAGAATAAAGGGCATGTTT
TGAAAGTGTGGAAAAGCGCTTTTTTGTTTATAGAATGAAT
GTCTATTATCAAGATTTCACACTTTATTTTTACAAACGTA
CAAATTGAGATATCATGTTGTGTCACTTTCAGAAGCACAT
CATGTTATTTATTCTGCTCGTTTTAAAAAACAGATTACAG
ACTCAACACAAATAGATCGTTTTTACAAATTTAAGTGGAT
TGAACATAAAACATTTAAGTTCTCCCAGAAGAAACTTAAG
AGTTTTGTTGTTTGAACTCACTTTAAATAAGTAGTTTAAA
CGAGCAGCATTTTTGACTGTATATAAGTAGTTCATTAAGG
CAGGTTAAAGCCATTTAAGAATAGCGTGCATTTCTTTATG
CCTTTCAAAGCTTTAACTGGTCCTACCTCTATTGTATTAA
AAATATGACATATGTGACATAAGAATGTTATCACATGAAT
GTTTAATAACACAATGTAATAAATTAAAAAAGGAAAGATT
TTCCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations