header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12170
Transcript Name: vtna-201
Previous Name: vtna-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029790 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029790|OTTDARG00000022944|ZDB-GENE-050522-440 vtna|OTTDARP00000024309 vtna-001 LG_ CR522882.5 Danio rerio protein_coding KNOWN, 1855 bp
ACATTCTCTGTGAAACACCAGGATGAGGGTTTTTCTTCTG
CTTCTCGTACTGCTTTCTTTTGCAGACGCGGCTGAAGAGT
CATGTATTGAGCGCTGTGAAAATGGGTTTGACGCCACCAA
AAGCTGTCAGTGTGACTCGATGTGCACATACTACAAGAGC
TGCTGCACCGACTATGAGTCCTTATGTCGTATCAAGGCTC
GTGGAGACACCTTTCCTTCTCACCCCGAGGATGATTATGA
TGAGGAAACAAACAGCACAGAGGTTCCAATCAGATCTAGA
CCGCAGGTCAGAGTTTTGTCTCCATCTCCTTTGGAAATAT
CCAGCATGGTAACACCAGTTTTGGATACAGCGAATGAGCC
AACACCAGTCGTTGCCACTGCTGCCACTCCAACCAATAAA
AACCCTGCCACAACACCAGGTGCAACCACAACTGCTCAGC
CCACACCAACTAAAGCCAAAGACCCTGATGCAGAGGTGTG
CAGCGGCAGACCCTTTGATGCCTTCATGCAGCTCAAAAAT
GGCTCTATATATGCATTCAGAGGTGAATATTTTTTTGAGC
TAGACGAGAAATCGGTATTACCGGGTTACCCAAAGCTCAT
CGAAGACATCTGGGGAATAAAAGGTCCAATTGATGCTGCT
TTCACTCGCATAAACTGCCAAGGAAAAACATACATCTTCA
AGGGTAATAAATACTGGAGGTTTGATGATGGTGTATTAGA
TGATGACTTCCCACGAGACATAGCTGTGGGATTTGAGAAG
ATACCGGATCATCTGGACGCTGCCTTTGCCACTCCTGCAC
ACAGCCATCATGGCAAAGAGAAGGTTTATTTTTTTAAGGG
AGATCAATATTACCATTATGAGTTCAAGCACCAGCCATCC
CATGAGGAATGCATTAAGATGTCACTGAGATCTCCCTCAA
TGCTCTTCAGAAGATACACCGATATATACTACGACCGATG
GACTGAGCATTTCAACCAGCTTTTTGGTGGAGCTCAGAGT
CATCACGGCCATCACTTCATCAACAGAGACTGGATTGGTA
TCAAATCCCCAGTAGATGCTGTGCTAGTCGGCAGACTCTA
CGTCACTCCGAGATGGCAAAACAGAAGGCGCCAGGACAGA
AATCGTCAGGACTGGGACCAGCAGCAGGGTCAGCAATATG
GGCAGCAGTGGGACCAGCGTTATGGGCAGCAGTGGGGCTC
CAGACGCAGACAGAACAGATCACCCTACTGGGAGAGCATG
GCTGAAAGGGGAATCAGCATTGGGCAGGAGTTCAGTCAGA
GGTTTGGGCAGGACAGGTGGCGAGACCAAGACAGACGCAG
AGACTACTATTATGACAGACAAAATGACTACGATTATGAC
TACAGATACAAGCCTACTGAAGACATCGTCTACAACATAC
TGCGCAGGAGTCAGCCTTTACAGAGTGTCTATTTCTTCAA
AGGAGATAAGTATTACAGAGTGAATCTCCAAACGAAGCGT
GTTGACTATGCCAACCCTCCATACCCAAGACCTATTGGAA
AATACTGGCTTGGCTGCAAAGACACGTCGGGAGCAGAAAA
ACGATGAGTCCATCTATAAAACACTGCCATTCAATAGTAT
TTATCATACAACAAAAATAAGTTCCTTTATACAATATCTG
TGCTGGTTTTCACACTAATAGAAAGACGCTATTCATAATG
TTTTACAGGCCACCGTAGGAACTACTCTGAGTTATATTCT
TACTCATGCTCAGTCATCATGTAATTTTTATTCAAAGTAT
AACAGCTTTAATGAACCAATATATGGATTTGATCATATTA
GAATTGTACTAATATGAAAATAAAAAGATCGTCTGCAATC
TTCAATAAACATCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vtna-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000029790 (1),  Ensembl_Trans:ENSDART00000077736 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC095724 (1) 1883 bp
CITATIONS (2)