ZFIN ID: ZDB-TSCRIPT-090929-12103
Transcript Name: synj2bp-201
Previous Names: synj2bp-001, zgc:56207-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029723 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029723|OTTDARG00000022904|ZDB-GENE-030131-6531 synj2bp|OTTDARP00000024256 CH211-67F24.4-001 LG_none CU929456.8,BX927407.11 Danio rerio protein_coding KNOWN, 1273 bp
TAGGCGGCAGTGGCGGGTACGCTGGATCCCCGGCAGCGTT
AGAGGAAGCAGGCGGAGTTTACTGTCTTCAGGAGGGTTTT
AGCTGTTCTGGAATAAAAGTGAAACTTTTCCGACATCATG
AACGGATCCGCACACAGCGCGCCAAGCGATGTTGAATTCA
CGCTGAAAAGAGGCCCGGCCGGTCTGGGGTTTAATATAGT
GGGTGGAGTGGACCAGCAGTACATGATGAATGACAGTGGA
ATCTATGTGGCAAAAATCAAAGAAAACGGAGCGGCTGCGC
TGGATGGTCGTCTGCAGGAGGGAGACAAAATTCTTGCGAT
AAACGGCAGAAAGCTGGACAATCTGTCTCACGGTGCAGCA
GTGGAGCTGTTTCGCTCTGCAGGAGAGGACGTGCATCTCT
GCATTCAGCAGCGACCTGTCCTGCAGAACGGCCCCACCAG
CTCTCGTGCCGATGGAGAGTCTTCCTCTGCTTTGGGCACA
TGGACACTGTTTGCTGTAGTCACTCTGGCCGTTATGACAG
CCAGCTTCATCGCTTACAAGCGCTTTCATCCCCGAGGGCC
CCGGGGCCCATTTTAACTCATCACATTTTACAGACTAAAG
CTTCTCTTTATTTTTTTTCGTAGTTTTTTCCCGAACTGTT
CTGCTGAGGGCCCAAAAACATTAACATGGAAGGGGAAAAA
ATGGAAAGCCAGTTAATGGAGGGAGAGTTTTTGTTAATTG
ATTTTTCCATGAAATGACGACACACACATGTAGCTGTAAC
ATGTTTTCACAATTCATTCGGGGATGATCATTGGCGTTTA
CCCAGAATCCCCAGCATGCCTGATGATGACATTGCACGGT
TAAACGAGGGATCTGGACGGATGAGCACTGTGTTGGAATA
GGAAGTCTCCGTAAAGTGAACCAGACAGAAGGACTGCAGG
CGGGAGATGGAGGCCGAGGTGGAGCAGCAGACAGACCCGC
AGAGGAATGGTTTTATTCTTCCAGAGCGCTGGAATGAGCC
CGAGGTATAACAGATTATACTTGAGGTGTTCTCAGGTACC
TGCTTGTGCAAGAGTATGTTTTAAAGCGTGCATGATGTGG
GTTAATTCTTTCTCTTTTTTTTTTTATACTTTAATTTGTC
ACTCATCCATGTTTGAACATGCTTTTCCATGGCTGTGGAA
GTAGTGCTGGGGGAGAGGTTTGGTATCTTTATTTGCAATC
AGCACTAGGCCTTGTGTTGTATCTTCTATTCCTCCTTCAG
GGAAAAAACTAGAGGTTGCACTAGTAAGAATTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
synj2bp-201 Contained in:
[BAC] CH73-313O21 (1), CH211-67F24 (1)

Genome Resources: Vega_Trans:OTTDART00000029723 (1),  Ensembl_Trans:ENSDART00000030133 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC045991 (1) 1651 nt
GenBank:DN770417 (1) 875 nt
CITATIONS (2)