ZFIN ID: ZDB-TSCRIPT-090929-11929
Transcript Name: mapre3a-201
Previous Names: mapre3a-001, zgc:114065-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029540 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029540|OTTDARG00000022808|ZDB-GENE-050913-88 mapre3a|OTTDARP00000024111 mapre3-001 LG_ BX571720.6 Danio rerio protein_coding KNOWN, 1496 bp
ACCAAGCAGCAGAAGAGCGCATATCTGGCAACCCACAGGA
GCAGCAGCGGATTGCCTTCAGCCAGTGTAATAACAACATT
GGAAAGGACGCAGTCAAAATACAGAGATGGCAGTGAATGT
ATACTCGACATCAGTAACAATTGAGAACCTGAGCCGACAT
GACATGTTGGCATGGGTGAACGATTCCCTTCAGCTCACCT
ACACCAAAATAGAGCAGTTATGTTCAGGGGCGGCTTATTG
TCAGTTCATGGAGATGTTGTTCCCTGGGTGTATTCTTTTA
AAGAAAGTGAAATTTCAGGCAAAGCTGGAACATGAGTTTA
TACACAACTTCAAAGTACTCCAGGCAGCTTTTAAGAGGAT
GAACGTCGATAAAATAATTCCTGTGGAAAGATTAGTGAAA
GGAAAATTCCAAGACAACTTTGAATTCGTCCAGTGGTTTA
AAAAATTCTTTGATGCCAACTATGATGGAAAAGAATATGA
TCCCATCCAAGCTAGACAGGGCCAAGACGTGGCGCCTCCA
CCAAATCCAGGGCCTCAGAGAACATCACCAACAGTACCTA
AAAACATGCCCACGCCACAGAGGGTGACGACCACCATAAG
GAAGAACCCCACACATGCCCGAAACGGGGGGAGTGATGCT
GAAATCACGGAGCTTAATCAACAGTTGATGGAGTTGAAGT
TAACTGTTGACGGTCTGGAGAAGGAGAGAGATTTCTACTT
CAGCAAACTACGAGACATTGAACTGATCTGTCAAGACCAT
GAGGCTGAAAGCAGCCCGGTTATCAGTAGGATAATTGACA
TTCTGTATGCCACAGAGGATGGCTTTGCACCACCAGAAGA
TGATGAAATCGACGAGCAGTCTCACTTGGACCAGGACGAA
TACTGAGCCTCCTCTTCCACATGGTCGTGACCCGTTCACC
ATTTCCTCTCCCCATCACTTTGAATGAGTCCCCCCCAAAA
CGCACGATCTTAAAATCCCCTCAGTTTCCTCCAGATCTAT
GGGCTCACCATATATACTCGATCTGTTTGTCCTCTGACAC
TGGTTTATGCACCTCATCCAGACAGTAGCATCACCACCAC
CACCAACAACAACAACACATCCTAGCAGTCTCAGCATGTA
TTACATATCGACATAGAGAATGAACTACAAAGGTAGGCAT
ATATTGTGGGTAGCGCAACGGACTGAGAAAAAAATGTAAA
TATTGTGATGGGAAAGACATTTTTAAAAGGAAAAAAGTAG
ACAGGTGTCTCCTGGAATGCAGTCGTTTGTTGTGAGAATT
TCATACACATTTCCTTTAAGGTCTGCCTTGGCTCCATTCA
GTATGAAATGATCAGTATCAGTCTATCATCTGTGTCTTCG
GCTCTAATGTGTTTCTCTCACTGACTCCACACTTTACATT
TCTGATAGTTCACTCAGAAATAACGATTCTGTTTTCATTT
ACTCACCGTCAAGTTGTTCCTTACCTGTAGGACTTTACGA
AGAGGGATAAAAATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mapre3a-201 Contained in:
[BAC] DKEY-77G5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000029540 (1),  Ensembl_Trans:ENSDART00000045287 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC097127 (1) 1528 nt
GenBank:CO919040 (1) 764 nt
CITATIONS (2)