ZFIN ID: ZDB-TSCRIPT-090929-11925
Transcript Name: lrrc57-201
Previous Name: lrrc57-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029536 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029536|OTTDARG00000022806|ZDB-GENE-040718-372 lrrc57|OTTDARP00000024108 DKEY-176M20.2-001 LG_ BX294375.7 Danio rerio protein_coding KNOWN, 1422 bp
GGATAGGAGGAGAATAACGCAGAGACGCTTCAATCAACTG
TATCCACATAAACAAACGCCCTCCTTGGGGATGGACAAAG
TTCCGTAGCTCAACGTTTAATAATCATCAACTTAGGTCAC
TATTCAATAATATTGCATGTTTTGCTATATACTTTTATTA
AAACGTTGAGTGGAGGTTATATTGCTCTGTAACCAACTGG
ATTGTGTGAACTTTTCCTGTCAAACTGTGGACTTAAAGGT
AGCCAGTCGAGCTAACTGGCTAAGATTTGCTAATATTAAA
TTCATCAGATCTGCAGCATCCTTGTCCTGTAAATGGGGAA
CAGTGCGCTCAAAGCTCATTTGGAAACATCTCAGAAGACT
GGAGTCTTTCAGCTGACCGGAAAGGGTTTGACAGAGTTCC
CAGAGGACCTGCAGAAGCTCACAGCAAACCTGCGGACAGT
CGATCTGTCCAACAACAAGATCGAGGAGCTTCCAGCGTTC
ATAGGAAGCTTCCAGCATCTCAAGAGTTTTACCATAAGCT
GCAATAAACTGACCAGTCTACCAAATGACATTGGCAAGCT
CAAGAAGCTGGAAACCCTTATTTTAAATGGAAACCAGCTA
AAACAGCTTCCTTCTTCAATTGGTCAACTCAAGTCCTTGC
GCACACTGAGCCTGTCCGGCAACCAGTTTAAAGAGTTTCC
CAGTGGCTTGGGCACCCTTCGCCAGCTTGATGTTCTGGAT
CTTTCCAAAAATCAGATCCGAGTGGTTCCTGCAGAGGTGG
CCGAACTGCAAGCCATTGAAATCAACCTCAATCAGAATCA
GATTTCAAGCGTGACTCAAGAGGTGTCTCGCACACCCAGA
CTGAAAGTCTTGCGGCTAGAGGAGAACTGTCTGGAGCTCT
CCTCTATCCCCCTCTCCATCCTCACAGACTCCCAGGTGTC
CCTGCTGTCTGTCGAGGGCAATTTGTTTGAGGTCAAAAAG
ATGCGTGACCTGGAAGGATACGATAAATATATGGAGCGTT
TCACTGCAACCAAGAAGAAATTTGCGTGAGCAGTCGGCGG
ATTCCTGCTTCTGTCCTCAGCGCTGGGCTTTACAGTAGAG
CGATTACAGCTTCCACTGCACATATAAACGTCCAGACGGT
GGGAAAAAAATGGTCAGGCCTGCTTCACAACTCGACAGAA
AGACTCAGGTGCTGTTACAGAGAACACTATGAATTACTGT
ACACACCCACAGAACATCACTCTATCATTTGCAAAGATTT
TATAAAGCCAAATATAGCTTTACCAGGACATTCACACTGG
AGAATGAACATGATAACATCACGTCAAGAAGGTCTAGTCT
TCACAGAGTGGCGAGTTTAACAATGTATGCCATTGCCAAG
CGTTTATTAATCCGTTTATTTGATGGCTTTTGACTTTATA
ACAATTAAACAGACTTTTTTAA

lrrc57 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA lrrc57-201 1422
lrrc57-202 (1)    Ensembl 829
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lrrc57-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000029536 (1),  Ensembl_Trans:ENSDART00000064515 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC075955 (1) 1363 nt
GenBank:CO815761 (1) 853 nt
CITATIONS (2)