Transcript

kif1bp-201

ID
ZDB-TSCRIPT-090929-11906
Name
kif1bp-201
Previous Names
  • kif1bp-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029516 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029516|OTTDARG00000022795|ZDB-GENE-070117-1989 kif1bp|OTTDARP00000024094 kbp-001 LG_ BX546482.15 Danio rerio protein_coding KNOWN, 2231 bp
TTTATTGCTAGAGGGAAACATGGCTGCCAACAACAGTATC
GAGTGGAGGGCCGTGTGCGAGAAATTTCGCCTTGCCCAAG
AGCTTTCCGAAATAGAGTCGAAAAAAGACCCCGAGAATAA
CCCTTTCCGATCGAAATACAAAGCCAGAGATCTGCTGAAG
GAAATCCACTGTTCTTTGAAAAAGATTGAAATCGAGGAGC
AGGGCGAGGCTGGGGATGAAGCGGACTGTGAGTCCAGCCA
AACGGCGGATGGTGAGCCGGAGGATGGTTTTGAGAAAACG
TTCACTGGAGACTCTGCAGCCGGCCTGAGAGCGGCCAGGC
TCGCGGTGCTGCAATATCATCTCGGCGTGAACCACATAGA
GACGGAGGAGCTGTCGGCTGGAGAGCTGCACCTCATGGTC
TGCATGAAGCTCATTGACAAGTGCACCACAACACGGGAGA
ACGTCTCCTTATTTATACATGTCCGGAATCAGCTCGGCAT
TTTGTGGGCGGGAAGAGATGAGATTGAAAAAGCACAAGGA
TTTCTGGAGATTGCCGAAACAATGTATTTGGTCTACATGA
AAGAGGATGGTCAACCACCCCTGGATCTTCAAGACTTTTT
TGTGCCAGAAGGAGAAGAATTATCCCAACAAGAGAAGATT
AGAAGGTTTGAAATGGCATATACGCACACGCTGTATTACC
TGGCTCAAGTGTACAAGAATCTTCAGCAGTATGAGAGAGC
TGCACAGTACTGTCACAGCACCCTACAGAGACAGCTGGAG
TACAAGCAGTTTGCGCCTCTGGAGTGGGCCATTAATGCAG
CCACACTGTCACAGTACTACATCACCAAGACCCGATATAT
GGAGGCTCGTCATTGTTTGGCTGCTGCCAGTGTCATCGCT
AACCTTGCTGGAGAAATCCCCTCAGAGGCAGCTGCCAAAG
AAAGTGAGGCTGAAAGTGAAAAACGTGAAGAGCTCCTGCA
GAAGCGAGCTGAAATTGCCAGATGCTGGATCAAATATTGC
CTTAATTTGTTGCAAGATGCTAAAAAACTTCTTGAGGATA
ACATTGGAGAACTAGACTTGGACCGTCAGGATGAACTAAA
GAGAGCACGTCGAAATGAAGAGGAAGAAAAAGAGAAGGGA
AGAAAAAGCGCCATCCTTTTTGGCTCAAGCGATACCTTCG
ACTCCATTTGCAGCCTGGAAGAGAAAGTAAGTAGCATGCT
TCCACTGGAGTTTGAAGAAGCCCGTAGCATCTTCCTGGTG
GGTCAAACCTATGTCACCCAAGCCAAAGAGTATTTCGCGA
TGGATGGTCACGTGACAGATCACATTGAGATCTTGCAGGA
CCATAGTGCGCTCTTTAAAGTCCTGGCCTTCTTTGAAGAA
GATCTGGAACGACGCTGTAAGATGCACAAACGCCGCGTCG
ACATGCTGGAGCCTATCTGCAAGGATCTGAACGCTCAGTA
CTATTTGTTAATCTGCCGGCAGCTGCAGTTTGAACTTGCC
GAAACCTATTACGAGATGATGGACCTGAAGCTGGCGGTGG
CCGACAAGCTGGATCAGCCAGATGTGCACACCATTAAGAA
GTTCAACCACTTGTGCTCGTCCTCCATGAAGTATTATCAG
ATGTTCCTCGACTCCACTCGTTCACCAGAGGGCAAGTTTC
CCGAAAAGCTGGAGGATGACCTGCTGAGGCCGGCGCTGGT
CGCCAAATTCCGTGTCGCCAGATTACACTCCAAGCTCATT
TCCAGTAATCTGGCCACCCAAATGGAGAATCTCAGTCTTT
CACTGGAGTCCTACAACTTCGTAGTGCAGTACTGTGAGGA
GAATCCAGAAGCCAAGAACGCTGTAGAAACCGAGCTAGAG
CTGAGTATGGAGATGGTCTCCCTGCTCCCTCTGAAGATCA
ACAGAATTCGATCCACTCTGGCCTCCTCCAAGTGAAATGG
TGAATGGTGGCCTTTTACATAAATATGAACACCTGACAAA
TGTACACTACCCCTTGCTCCATACCAGACCTATACAGTAG
ATGCGTCTAATGCACTTTCACTGGAGCGCCTGTAAGAAAC
TCTTCCAGCCTCTGTAACAGTAACAGTAAACTCTTGTGAA
CTGATGTAACTGCATGATTTACAGTCACTAATTTATTTCC
AATGTGCAATTTTATTTTAAGCAGTGAAATGTTCAATTGT
TATGTTCAAAACGAATATGTAAGATAACTGTACTAATAAA
ACATTTTATGCCAATAAACAATCAAAAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations