header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11773
Transcript Name: macrod1-201
Previous Names: macrod1-001, zgc:92353-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029375 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029375|OTTDARG00000022721|ZDB-GENE-040912-100 macrod1|OTTDARP00000023989 macrod1-001 LG_none CU855924.16,CU929357.6,BX004778.4 Danio rerio protein_coding KNOWN, 2132 bp
GTTGGTACAATCCTATTTACCTTCATCTTATCAGACGTTT
AACTTTCAGTTTCACTAGTGTTAATTCACAACCTGCATAT
AGACTGAGTGTTAAATTTATAGCGAACTCCAATTCGAGGA
CACATTGAAAGCGACCTTAAACATTTAATCAGCAGCAGTG
AAGAGCAGATCATGGCGTTTCAGATGTCTAAAGTGTCCGC
TCGTGTTTGTGTTTGGAGTCGCAGCTTCAAAGCGCAGTTC
TGCTCTGGTGTTACCCGTAAAGCAGGCCAGTTTGAGAAGC
TTTCCGCAGCCGCAGTGTGTGTTCCCCGGCCCGGCTATGC
TGCTGTGATGGGGCTGCGGGTTGTGCTCGGCGCTGCGGGG
GTCTCAGCGGCGGCGTGCGCGGCCCTGAGCACGAGCACGC
TTTATGCCATGAGCGCGCGACCCGAGCTGAACCTGGAGTC
TGACAGAAGCGACTGGAAACAGGCGAAGACTAAGCTTTGC
TCCATGGATAAGGAGAAGAGAAGGGAACTGTACAGGGTTG
ACTTCATTCCATTGGAGGACGTTCCTGTCTGGAGTCCGTC
AGGTGACTCTTCTTGTAAACCTCGCTGCGAAGTCAATGAA
GAGCTAAATATGAAAGTATCTTTGTTCGGCGGTGACATCA
CAAAGCTGGAGATCGACGCCGTTGCCAATGCAGCTAACAA
GACACTTCTAGGTGGAGGAGGAGTGGATGGTGCCATTCAC
CGTGGAGCTGGTCCTCTGCTGCGGAAAGAATGCGCCACTC
TGAACGGCTGTGAAACGGGGGAGGCCAAGATCACCGGAGC
CTACGGTCTGCCAGCGAGATATGTTATTCACACCGTGGGG
CCGATAGTCCATGATTCAGTGGGAGAGAGAGAAGAAGAAG
CGCTGAGAAACTGTTATTATAACTGTCTGCACACAGCAAC
TAAACACCACCTGCGGACTGTGGCTTTTCCCTGCATCTCT
ACTGGAGTTTACGGATACCCACCTGATCAAGCGGTCGAAG
TTGCCCTGAAAACAGTGAGAGATTACCTGGAGCAAAACCC
AGAGAAGCTGGACCGGGTCATCTTCTGTGTGTTTCTGAAG
TCCGATAAACAGCTCTACGAAAATCTTTTACCTGCATACT
TCCCTCGAGGTTCACCGCCAAAGAGCAAATTATGAGAGGA
TGTCAGAGTTGCTGTGGAAACGCCACCCAGCCATTGCTTT
TCCGCCACATCACAGCCTCGCTATAACCTGACGCAGACGC
CGCAAACAACAACAACAGCAACAGCTTCCTGACACACACC
ATCTGATTTATTCACATCAAGCAAACCAGCTCTGCACTGA
AGACACGCTATCTGCTAACCAGTGGGGAATCAAATTGTCA
TCGATTTTGTGCTGATGTTGATAACAGTGTAGGCTTACAA
ATGCTGCTTCACACAATATTTCAAGTCAGACGGTAAAAAA
TATTTGTTAGTTTTCATTTCTGTGTGATTCACGGGTGTTT
TCTGTTTATGTATGGGTGTTAATTGCATTATGGTAGTAAT
GGGACATAGATTACTGCTCTGTTGACTTTTAGTGTTGAAA
GCTCAATTGTGTAGTTTAGCAAAGTGATTTTTATTCATAT
TTTAGTAGTTTGAAGCAGTATAAAGTGTAAAACAATTACA
TATATATAGAATTATTTCTGTAACACTACCGAAAAAGTAC
AGATGATTACTTTTAAAAACGCCAATCCAGACTATTACTT
CAAACTAATAAAAATGTCAACGTTAAATGGAGGAAATATC
AAGCTTCCATAATGTAATAAATACAATTTATAAATAAAAA
AGGCAAAATATGAATCACAAAATATGGACAACTGTTAATA
TGTGGATGTTTAATAGTGTCTGCTGTATGCCTTTCAGTTG
AATTCAATTTAGGTCAGTTTACTGTCATTGTACGTCATAC
AACGAAGTTCTGTCCGGTGAATGATGTACGATGACAAAGT
AAATTGAATTGAACTGAAATGCATACACAAGACCGCCTAA
ACTAAGTCTTCTGTATTTTGCATTAGATTTTCCTTGAACT
TGTCACTGTTTGAACACCTTGAAAAATGCATCTTTCATGA
ATAAGTGAACTGTAATTTTACACTTTCAGAAATAAAGGTA
CAGTAGCTGTCA

macrod1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA macrod1-201 2132
macrod1-202 (1) 806
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
macrod1-201 Contained in:

OTHER macrod1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029375 (1)
  • Ensembl_Trans:ENSDART00000043751 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC081655 (1) 2088 bp
    GenBank:CK140775 (1) 867 bp
    GenBank:CA477518 (1) 866 bp
    CITATIONS (2)