Transcript

zbtb8a-201

ID
ZDB-TSCRIPT-090929-11771
Name
zbtb8a-201
Previous Names
  • zbtb8a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029373 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029373|OTTDARG00000022719|ZDB-GENE-060421-5153 zbtb8a|OTTDARP00000023987 CH211-195O20.2-001 LG_ CR391986.5 Danio rerio protein_coding KNOWN, 2314 bp
GAGGCGTTTAAAAGATTGTTAAACCCCTGCACTGTAAGAC
AGGCGGGTCAACACAGTGCAGAAAAATACCATAAAACGAG
CCATTTCTTCATTTTGAAGGGCAGAAGCTGGTCGTGTAAA
TGTGCAGGGGTTGCTGTACGGGGGCGCGTGTGCTTTAAGC
TGTTCTCCGGTCCCGGGCGCTCCGGACACCCACGTCAGCA
AAACGTTTTTCTAGCACAAACGGGTTTCGGTCTTTCGGGC
AAAGCAGGAAGTGAAAGCCGTTCGCCCTGATAACAAAAGC
TGGAAAAATACATCCAAAGTCGGCAGAGAAATGGAGATGG
TGTGTGAAAGTGGGACATGTCGACCGTACCGGAGCGCGGG
TGACGCGGGGCATCTGCCTGTTAACAAATGGACCAGTGCA
GACATGTCAGCCATCCACCAGAGCTGTCTGCTCAAGCAGC
TGGACCAGCAGAGAAAGCAGGAGCTGTTCTGCGACTGCAG
TGTTTTGGTGGAGGGCCAGATTTTCCACGCTCACCGGAAC
GTCCTATATGGCAGCAGCGGATATTTCCGGATGCTCCTGA
CTCAGGGAGCCAAAGACACTGTTGACTCTGTAAGTGCCTC
TTTTGACGTCTTCAGCCCTGATATCTTCACCATCATCCTG
GACTTCATTTACTCCGGTCAGCTGGAGCTCAACAGCTCCA
ACGTAATCGAGGTGATGTCAGCTGCAAGCTACCTGCAGAT
GAACGACGTCATTTCCTACTGCAAAGCCTTCATCAAGTCG
TTCCTCGAGATCAGCACGAAAGAGGACGATGAGAATCGGT
ATCTGTGTTTGTCTGAGAACAGCTCTCTTCAGGACAGACG
TGAGAGCACTATCGAGCCGTCCAACATGTGTGATGTCAGC
ATGAGTTCTCAAAGCAGACTGTGGGATGAGGAGCAGGAGG
ATGATCAGCCGCAGGAGGACTTTGGAGGGACGAGCCCGCA
GCCGTCAGGACTTCAGCACAACTCTCCTGCACAGTCCAGC
CTGGAGGAGCAGTACAGCTCGGTGCTCCCAGAACGCAGGA
GGAGGGGGAGCAGGAAGAGGACGGCCTCCAGTCGCCTGGT
GGCAGAAGATACTTCCCTCATTGACCTGCAGGGGGTGGTG
TCACACTGCTCGCAGAAAGCAGACGAGCTCTACGCCAACC
TGCCTTCCATTGTTGGGGTGGTCGGGATGTTTAACAAAGA
TGCCACTCCCTCTATGCGCTACAAATGCCCGTTCTGCACT
CATACAGTAAAGAGAAAGGCAGATCTGAAGCGTCACCTCC
GCTGTCACACTGGTGAGCGTCCGTATCCCTGTCAGGCCTG
CAGCAAACGCTTCACCCGCCTGGAGCACCTGCGCAGCCAC
TTTGAGACGATTCATCAGGCCCGTAAGCTGGTCTGCAGGA
AGTGTAAGCGGCATGTAACTGAAGTCAGTGGACGTGTGGT
CAGTGAAGGGACCCGCAAATACAGGCTCTGTGACGTTTGC
ATTCAGGAGAGCGGCTACAATGATTTAATCACAGATGAAA
CAGATGGAAATGAGGACAAGGAAGGCCTGTTGTTGGGTGT
GGACGAGGACATGAGTGAAAACAGGCAAATTACATGGGTC
ATGGATGATGATGATCTAGCGGAAGATTCTGGAGCCGATC
TCATAATCCAGGAAGTGGACGACAGCGACGAGGAAGCAAG
TGGAAAGTGATGATAGATTTGTGTGTGATTGTGTGAATGG
GCAGAGCTGCCTTATTGGCGGTTTAAGGTCTGTTGAAATT
TCATAAGGGAATCTATGTGCGTTTTTGTACAAATAAAACA
CTTTGTCTTTTAAAAAAATATATATATAAAGTATTAAATA
TTACTGCTTTTATAAAAGTACAAGTATATTTCTGTAATTG
AAAGTATATTTAGCTTATTTCAAGAAGGCTTTTATGGGCA
CGATGACAGCGTGATCAGTTATTGTTGATACAGAGCTGAT
CTAATGGAACTTCACTCTGTAATTCTGCCAGATTTCTTGC
TTTGACTTCAGTTTTCAGACTTTAGTCAATGCCAGGGCTT
ACATATATGATTTTATGTTTTATGCTGCATGGAGTCCAGG
CGACCTACTTTTTGTGATGTGTAACAGACTCATTTATTTA
TTTTCAACAAAACAAATTATCAGTCACAGGCCAAACATAA
ACAGCGTCTAAATAAAATATTGTATATATGAATGAATGTG
TTTATGCTTCACTCTGGATGTGTCACCTTTTGCTATTTGT
CTTGCTTTTGACATTCAATTTATTTGTGTTTCGATTTATT
TGGACAAAAGAAAATATATTTTATACACATGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations