ZFIN ID: ZDB-TSCRIPT-090929-11710
Transcript Name: zgc:63568-201
Previous Name: zgc:63568-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029300 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029300|OTTDARG00000022674|ZDB-GENE-040426-1165 zgc:63568|OTTDARP00000023930 DKEY-5I20.2-001 LG_ CT009687.10 Danio rerio protein_coding KNOWN, 1741 bp
GATTCCGCTGCGCAGAAGAATGACTGTTAGCCAATCAGAT
GACGCTTGGCCAGCATCCCAAATTCTGAATATAGAAGAGT
AGGAAAGAAATATCAACAACAAAAGCGCTCTTCTGAACCT
AGATTAAAAACAGTAGACAGTTGGTTAATAGTCCCACTAA
CGTTAGTAGAAAGATTCACTGTGAAGTGTATGGTTGCTAT
GGAAACTGAGGGTAAGGTGATCAAGTGTAAGGTAGCAGTG
GCTTGGGAACCAGGAAAACCACTATCCATTGAGAAAGTAG
AGGTCGCCCCTCCCAAGGCACATGAAGTACGGATCAAGAT
TGCTGCATCTGGCGTCTGTCACTCAGATTGGGCTTACCTG
TATGATATTGCTAAAATGAAGCCACGGCCGTTTCCTTTGG
TTTTGGGGCACGAAGGGGCAGGAGTGGTGGAGAGTGTTGG
TCCAGGTGTCACAAAGGTGTCTATAGGAGATAAAGTGATT
CCTCTGTTCCTGCCACAGTGTGGACAATGTGAACGCTGTC
AGAGTCCAAAGACCAACCTCTGCACCAAAAACTGGGAGAA
AACTCAACAAGGTGTTCTTGCTGATGGCACCAGCAGGATC
ACCTGTAAGAATCAGCAGGTTCATCAGTTTATTGGTATCA
GCACTTTCTCTGAATATACGGTTGTGCCAGAGGACAATGT
GACCAAGATTCACCCAGACGCTCCACTGGACAGAGTGTGT
TTGCTGGGCTGTGGAGTTTCTACAGGATATGGGGCAGCAG
TGAACACAGGCAAAGTGGAATCTGGCTCCACATGTGCAGT
GTTTGGTTTGGGAGCTGTGGGACTGGCAGCTGTCATGGGC
TGCAAAGCTGCCGGTGCCTCCAGAATCATCGCTGTTGACA
TCAATTCAGACAAGTTTGAGATCGGTAAGACATTTGGAGC
GACTGAGTTTGTGAACCATAAAGACCACAGTAAATCCATT
CAAGAGGTGCTGAGGGAGCTGACCAATGGTGGCGTTGATT
ATGCTCTTGAGTGTGTCGGCGATGTGGCGGTTATGCGGGC
AGCTGTGGAAGCATGCAGTCCTGCAGGGGGAGTCTGCGTG
ATTGTGGGCTGGATTGAGGTGGAGGAACTTTCTCTTGCCC
CACTGGATATCCTGCTGGGAAGAACTCTGAAGGGCACTTA
TTTTGGAGGCTGGAAGAGTGTTGAAGCTGTGCCCAGACTG
GTTCAAGACTATATGAGCCGAAAGATTCTCCTGGATGAGT
TTGTGACACACAGACTCGCTCTAGATCAGATTAACCAGGC
ATTTGATCTCATCGTGAGTGGGAAAAGCATTCGGACAGTG
ATTGAGATGTGATATTCCCAAAATCCTTCTAACAGACCGC
ACAATATCAGTGGTTTTGATGTGTTTCTCCTCTGCCTCTC
TATGGCCTAAATTTGTAATATAGTTAAAAAATGAGTTTTG
CTGGGTTGACACAGTAACAGCCATTATCAGACTACAATAA
AAGACGCTTTTGCAATATTTACAAAGGAAAAGAGATTGGC
AGGCTCATGCTTAGACAATGATTACCCACCTACCTGCTAA
TGCAAAGTTCCCTTTTAAGTTCCTGTATGTATAGTATCTG
CACATTTATAGACAGAAAGGAAAAGTCATTCATATTTAGG
GCACTGATTGTTCTTTTAGGCCATATTTTCAAAGAGCACA
TCTGTTCTGATCGGAGACTGTTCTACATAATAAAGCCGAA
GTTGATTTTTTTTTCTTATCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:63568-201 Contained in:
OTHER zgc:63568-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029300 (1)
  • Ensembl_Trans:ENSDART00000135079 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC055142 (1) 1735bp
    GenBank:BM141512 (1) 747bp
    GenBank:BI876740 (1) 702bp
    GenBank:CK674942 (1) 189bp
    CITATIONS (2)