header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11691
Transcript Name: si:ch211-236p5.2-202
Previous Name: si:ch211-236p5.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029273 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029273|OTTDARG00000022659|ZDB-GENE-081028-33 si:ch211-236p5.2|OTTDARP00000023912 CH211-236P5.2-001 LG_ BX248131.6 Danio rerio protein_coding NOVEL, 4259 bp
TTTGAAGTCTGGATAGTGGTCGAATCTAGTCTGCAGCTGG
ATATCTCAATAATATCCTCGATTCTTGTGGTGTTTTTAAG
AAAATACTAATTTGAGATGTTCTCCAAAATGACTGAACTC
CTCGTAGGTTAGGAAGGATATTGAGAAGCAACCGCTATTT
TGGAGCTATGGAGTGACTTCAGTTACTAACGGAAGTGAAA
CGAACCACATCGAGCGATTCGACATTGCCTGTAAAATGAG
CCTCGATTCGAAGAGAAAGAGGGATGATGTTCAGACAGAT
GAAGCTGCATCTTTGGGGTCCAGCTGTGTGTCTGAGAGAA
GTGTTGAATCCCTCCCACAGCCTCACAATTTCAGTCTAAC
AACACCATCTCCAGAAACCAAGCTTACCACAGTGACAGTG
ACCCCAGATCTGTTGACAGGATCTCCAGAATCCAGCTGTG
TGTCTATAAGAAGTGCTGAATCCATCCCACAGCCTCCTAA
TTTCAATATAAGAACACCATCTCGAGAATCCAGCTCTGTG
TCTATGAGAAGTGCTGAATCCATCCCACAACCTCCTAATT
TTAATCTGATAACACCATCTCGAGAATCCAGCTGTGTGTC
TATGAGAAGTGCTGAATCCATCCCACAGCCTCCTAATTTT
AATCTGATAACACCATCTCGAGAATCCAGCTGTGTGTCTA
TGAGAAGTGCTGAATCCATCCCACAGCCTCCTAATTTTAA
TCTGATAACACCATCTCGAGAATCCAGCTGTGTGTCTATG
AGAAGTGCTGAATCCATCCCACAGCCTCCTAATTTTAATC
TGATAACACCATCTCGAGAATCCAGCTGTGTGTCTATGAG
AAGTGCTGAATCCATCCCACAGCCTCCTAATTTCAATATA
AAGACACCATCTCGAGAATCCAGCTGTGTGTCTATGAGAA
GTGCTGAATCCATCCCACAGCCTCCTAATTTCAATATAAG
GACACCATCTCGAGAATCCAGCTGTGTGTCTATGAGAAGT
GCTGAATCCATCCCACAGCCTCCTAATTTCAATCTGACAA
CACCATCTCGAGAATCCAATACTAACAAAACACAGAGAAC
AATGAGTCCTGGACTGAAGAGAGATGCTGCTGTCAGATCA
GTGACTGACCAACACAAATCATCCATGAAGGACAAATACG
AGTTATTTGAGGGAATCAATCTAGCAGAGAATCAAACACT
CCTGAACAGCATCTACACACAGCTCTACATCATAGAGGGA
GAGAGTGAAGGAGTGAATGAAGAACATGAGGTTTTACAGA
TGGAGAGAACAGCCCGAACACAAGACACTCCAATCTACTG
CAATGACATATTTAAACCCTTACAAGAACCAGAACATGAG
GAGAAAGATCAGATCAAGACTGTTCTCACTAAAGGCATCG
CTGGAATTGGAAAAACCGTCTCTGTGCAGAAGTTTATTCT
AGACTGGAGTGAAGGAAAAGCCAATCAGGATGTAGATTTC
ATGTTTGTGCTTCCATTTCGAGAGCTGAACTTGATTAAAG
ATCATCAGTACAGTCTTCACACACTTCTGCTGGACTTTCA
TCCTGAACTTGAAGATCTGGACTCAGAGATGTATGAGGAG
TGTAAAGTCGTGTTCATCTTTGATGGTCTGGATGAAAGCA
GAATCACACTAAAGTTTTCAGACATTGAGAGAGTTAGTGA
TGTGAATGAGTCTTCATCAGTGGCTGTGTTGATGTCAAAC
CTCATCAGAGGAGATCTGCTTCCCTCTGCTCTCATCTGGA
TCACCTCCAGACCAGCAGCAGCCAATCAGATCCCTTCAAA
ATACATCAACCGTCTGACAGAAATTCAGGGATTCAATGAT
TCTCAGAAGGAGGAATATTTCAGGAAGAGAATCAGCGATG
AGCATCAAGCCAACAGAATCATCTCCCAAATCAGAAGATC
CAGAAGCCTCCACATCATGTGTCACATACCCGTCTTCTGC
TGGATCTCAGCCACTGTGCTTCAGAAGCTCCTGAATGAAG
ATGACAGAGCAGAAATCCCTCAAACTCTGACTGAAATGTA
CATCCACTTCCTGCTGACTCAGATCAACATGAGGAACCTG
AAGTATGAAGAGAGAGATCCAGAGAATCTCCTGGAGTCCA
GCAGAGAGATGATCGTGAAACTCGCTAAACTGGCTTTCAA
ACAGCTGATGAAGGGCAATGTGATGTTCTATGAAGAGGAC
CTGATTAGGAGCGGCATAGACGTCACTGATGCCTCAGTGT
ATTCTGGGATTTGCACTGAGATCTTTAAAGTGGAACTTGT
GATACATCAGAGGAAAGTCTACAGCTTCATTCATCTGAGC
TTTCAGGAGTTTCTCGCTGCTTTCTTTGTGTTTTACTGCC
ATGTAGTCAAGAATGAGAGGGCGCTGAAGTTGTTATTTGG
CCCCAATATCCGTTCAATCCTAGAACAATGTAGATGTGTT
TTTGGATTACATTGGGATGGTCCTGAAATGCATTTGTCTA
ATCTTCTAAATGAAGCAGTTCTTGAATCTTTAAAGAGTGA
AAATGGACACCTGGATCTTTTCCTGCGGTTTTTGCTGGGT
GTCTCGCTGGAGTCCAATCAGAATCTCTTACAGGGTCTAC
TACCACACACAGAGAGCTCCTTAGAAAGCATTAAGAGGAT
CACACAGTTCATCAAAGATAAAATTAAGGGCAAACAGCCT
TTTGGTTCTTCATCTACTAGTTTAGGACTGCTTTCATGTG
ATATGGTAAAGCCAAACAATTTGAGTGTTTCTGCTGAAAG
ATCCATTAATCTCTTCCTTTGTCTGCTGGAAATGAAGGAT
CAGACTCCACACAGAGATATTCAAGAATTTATGAAATCAG
AGCATTTCTCCGTTAGTCCGCTCACTTCCTCTCACTGCTC
GGCAATCGCCTACATTCTTCAGATATCAGAGGAGGTGCTG
GATGAGTTTGATCTGAAGAGATACAAAACATCAGATGAGG
GCAGATGGAGACTGATACCAGCTGTGGTGAACTGCAGGAA
AGCTCTACTTGACTGCTGTAATCTCACTGGTCAGTGCTGT
GAAAGTCTGTCTTCCTCTCTACAATCATCAAATTCACTGA
GAGAGCTGGACCTCAGTCACAATGACCTGCAGGATTCAGG
AGTGAAACTGCTCTCTGATGGACTGAAGAGTTCACAATGT
CAGCTTGAGATACTGAAACTTGCTGACTGTAATCTCACTG
GTCAGTGCTGTGAAAGTTTGTCTTCATTGCTACAATCATC
AAACTCACTGAGAGAACTTGTCCTGAGTCTCAATGACCTG
CAGGATTCAGGAGTGAAGCTGCTCTCTGATGGACTGAAGA
GTTCACATTGTCATCTGGAGATACTGAGGTTATCTGGCTG
TATGGTGACAGAGGAAGGCTGTTGTTTTCTGGCTTCAGCT
CTGAGATTAAACCCCTCACACCTGAGAGAGCTGGATCTGA
GCTACAATAACCCAGGACAATCATTAGTGGAGCTAATCTC
TGATAAAAACTACAGACTGACCACACTCAATGTGGACCAT
GGAGGAAAGATCAAGGCAGGACCACAGAAATATGCGTGTG
ATCTCACAGTGGATTTAAACACGGTCAGCCCTTATCTCGC
TCTGTCAGAGGGGAACAGAAAGATTACACGTGCGCGAGAA
GAGCAACCATATCCTGATCATCCAGAGAGATTTGATGAGT
ACAATCCTCAGGTTCTGTGTAAAGAAAGTCTGACTGGACG
CTGTTACTGGGAGGTTGAGTTGAGTGGTGGGGAGACCTAC
ATATCAGTGGCATATAAAGAAATCAGCAGGAAAGGATGGA
AAAAAGAATGCTGGATGGGATTAAATAACATGTCTTGGAT
TCTAAACTGCTTTAATAAGACAGTCTATGTCAGACACCAT
GATAAGTTTGAATTATTAAGTGAATTTACCTGTCCCATTA
ACAGAGTAGGAGTGTTTCTGGACTGGCCTGCTGGCACTCT
GTCCTTTTACAGCGTCTCTGACACAGACACACTCACACTT
CTACACACATTCAAAACCACATTCACTGAGCAAGTCCATG
CTGGATTTAGGATTGGCTGGGACTCATCAGTGTCTCTGTG
TGATTTATAATCCACTTTCATCAGACAGATCTGAGAGACT
GGCTGTAAATACAACTATGCTTGTTACATGTTCAGGAATG
CTGTGGGTTATTCTGGACTCCCATCCTATTGACTTTATTT
TTTACATACAAGCAGGTGCACTTCTATTGATTTTTAGATG
TTAAAAACAGCTAGTTGTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-236p5.2-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000029273 (1),  Ensembl_Trans:ENSDART00000145668 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)