Transcript

taar12i-201

ID
ZDB-TSCRIPT-090929-1167
Name
taar12i-201
Previous Names
  • taar12i-001
  • si:dkey-7c18.15-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000008168 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000008168|OTTDARG00000040746|ZDB-GENE-041014-61 taar12i|OTTDARP00000007210 taar12i-001 LG_ AL929507.37 Danio rerio protein_coding KNOWN, 1023 bp
ATGACTTCAAATGAGACGGACGTTTACGCTGAAAATATGT
TTCTCTGTTTTCCACACCTGCCAAACTCCTGTCCGAAATC
ACAACGTTTTGTTGTGGTCAAACTGGCAATGTATGTTTGC
CTGTTGCTGATGATCCTCACCACTGTTTTCGGGAACCTGC
TGATCATCATCTCCATCTCTCACTTCAAACATCTGCAGTC
TCCAACTCATCTGATCGTTCGCTCTCTGGCTGCCAGTGAT
TGTCTGCTGGGCTCTTTGGTCATGCCGTACAGCATGGTGC
GATCTGTTGAAGGCTGCTGGTATCTGGGAGATGTTGTGTG
TAAAGTTCATTCTAGTTTGGACATGACTTTCTGTATCTCA
TCTTTACTGCATCTCGGTTTAGTATCTATTGACAGGTACT
GGGCCATTTGTGACCCTCTAAGATACAGAATAAGGGTCAC
AAACACCACTGTCACTTTATATACTATCTTCATATGGCTG
TTTTCATTTCTCTACAGCTTTGTTATTGTCTTTTCAGGTG
TAAACAGAATTGGTTTGGAGACTTTTATCATGCAGGTTTA
CTGTGTGGGAAGTTGTGTTCTGTTTTTTAACAAAGAGTGG
GGTCTTATATGTCCAGTCCTCACATTCTTCATTCCTGGGG
CCATCATGAGCTCTCTGTATATGAAAATCTTCCATGTTGC
ACGAAAACATGCAAAGGTTATGTCAGAAAGAGTGACTGGA
GGGTTGAAGAGCCAAAGCTCTGCTCAAAGAGAGAGAAAAG
CAGCTAAAACTCTGGCCATTGTCATGGGGGTCTTCTTGCT
ATGTTGGACGCCTATTTTTATCGCTTCAATTATAGACTCT
TTTCTTAATTTTGTAACCCCTGCCGGTGTTTTTGATGCCT
TGATTTGGTTCGGATACTTTAATTCCACTTGCAACCCATT
GATCTATGGATTTTTCTACTCTTGCTTTCAAAAGGCCTTC
AAAATTCTACTTTCATCTCTTTTTCTTGGCTTTGGTAACT
CAAGCACCTTGACATTCGAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations