ZFIN ID: ZDB-TSCRIPT-090929-11493
Transcript Name: bpgm-201
Previous Names: bpgm-001, zgc:92230-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029063 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029063|OTTDARG00000022546|ZDB-GENE-040718-375 bpgm|OTTDARP00000023762 DKEY-206M15.4-001 LG_ CR387984.13 Danio rerio protein_coding KNOWN, 2096 bp
AACGGTTTACTGCTGTTTGTTGATGCTACTATGGTAGTTC
CTGTCGCAGAGCTTCAGCTGCTGGGCGGTTTCTGATCTGA
AGGCTTCCATACTACCTCTTCTGAATGTCCAAATACAAAC
TCTTCCTCCTTCGGCACGGAGAGGGAGCCTGGAACAAAGA
GAACCGCTTCTGCAGCTGGGTTGATCAAAAACTGAGTGAG
AACGGTGTGGTGGAAGCTCAAGAATGTGGCCGCCTTTTAA
AAGAGAATGGCTACCAATTGGACCAGGTTTTTACCTCCAT
ACTCAGCCGTTCCATCCACACTGCCTGGTTGGTGCTTGAG
GCCATGGGACACGAGTGGGTCCCTGTGACAAAATCGTGGA
GGTTAAACGAACGGCATTACGGTGCCCTGATTGGTCTCAA
TCGTGCTGAAATGGCATTAAACCATGGAGAGGAGCAGGTT
AAACTGTGGAGGCGCAGTTATGACATCACTCCACCTCCCA
TACATGAGTCACATCCCTATTATGCTGAAATTTACAATGA
CCGTCGATACAGTACATGTGACGTCCCGAAGGAGGAACTG
CCCAAAACAGAGAGTCTAAAGGAAGTGTTAGACAGACTTC
TTCCTTACTGGAATGATGTCATTGTACCGGTGATCAAAAG
CGGCCAGACGGTCCTCATCTCTGCACATGGCAACAGCTGC
AGGGCTTTGCTTAAACACTTGGAAGCTATATCTGAAACAG
ACATCGTCAATGTAACACTGCCCACAGGAGTACCTGTCCT
GCTGGAGCTGGATGAAGACCTTCGACCGGTCAAACCCCGT
CAGCTTCTGGGCGACCAGGCCAAAATTCAGGCAGCCATTA
AAAAGGTGGAGGACCAAGGGAAAGTTAATGCGCAAAATAA
ATAGGGGTAGAATGTTGGAGTCATTTACACAGGAAATAAT
TAAAGAGAAAGTTACTTAGTCAGTCAGGCATATAGTACAG
AGCCACCAGGTGAAGTTTGGCAAATTCCAACACAAAAAGG
CGTACCTGTGATTAGCTGGTTTTAAAACTGGTTTATGGTT
ATAGTGCTATTTTAAGAAACATAAAGTGAGTCAATATTTT
GAAGTTCCAAAATGCAGACTTGGCACATATATTTTGTTAC
AGCAAGAGGTCTGTAGACCAAATAATGAAGTATAGTTAAA
TATTTTAAAAATAATTTAGTAATGTGCGGTTATTTTTTGT
TAGATCTTGAATGGATTCTTTTTTCCAAGGGATTTTAGGT
TACAGAAAACCAGAGGTGCCTTCCTTTTGAGGGTAAAATA
GAAGACACCAGTTGTGTTCAAATAGAATTTGTTTCTAAAG
GTATTTAAAATTTAAATAAGCTATTTTAATCATATTACAA
ATATGTTTTTAATCAATTTATTGCATCCTGATTTTTTTTT
CAAAATATTTAAATTAAATTTACTGACCTAAAATGTTGTA
CGTTTTGGAATAATTCCAGATAAATAAACATACATTATTC
ACTCCACTATCCAGACTTTCCAAAACACAGACTAAACCTA
ATCGATGTGGATTCTTATTAATATTCAAAAAATCTGCTTA
TTAATTAACACTTAGACTTCATGTCTAAAGGATAATTTAT
AATATTTTGTGTAAATAGCACTGGTAGTATATTTTAGATA
TTATTTAAGTTATATAAAAGGGACATTTTGTTTTGATCTG
TATTTATTTAATATAGAGATATTAAGTCATAATAAGTTAT
GTTCAGTTTTCTCATGCAATGCCAAATGTAACCCATACTA
CCATTTTTTATCTTGTTCTCAACCAGAATGAACTTATTAG
CGAGTAAAACTAAGACATACCTGTTGTTTAAAATGTCCAT
GTGGTGTCACTGTAATCCCTGTATTTAGTTTTTGTGTATT
TGATGTTGCTCAACACTGTACTGTATCAATAGGGAAATGT
TGTATGTTTGTATTTTTGTTCTAACAGCCATGATGGCTTT
CGCTGTTACATATGTCTATGTTTACCCCTTTGTATTTGAC
TGTGGCACATCATAGCTCATTCACATTAAAAGTTTGGAAT
AATTAATTACAAATTAATAATTGTTACAAATTAAAATGTC
TGTTTGGGCCTTTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bpgm-201 Contained in:
OTHER bpgm-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029063 (1)
  • Ensembl_Trans:ENSDART00000104304 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC075949 (1) 2077bp
    GenBank:CN502225 (1) 866bp
    CITATIONS (2)