Transcript

zgc:66449-202

ID
ZDB-TSCRIPT-090929-11437
Name
zgc:66449-202
Previous Names
  • zgc:66449-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029006 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029006|OTTDARG00000022516|ZDB-GENE-030131-5618 zgc:66449|OTTDARP00000023719 DKEY-44K1.1-002 LG_ AL844894.14 Danio rerio protein_coding KNOWN, 843 bp
GGTGTCCCTTATCAAATTAATTCAGGTGTTTCCTTTCTTA
CGTATTTAAAAGATTTTTTCTGCTATGTGAACCATTTGAC
ACGTAGAATAAATATTAGGCTACTTTAAATTATCTAAAAC
ACATTTAAAACTTAAAACCAAAACAAAAGACTACGCAGCG
CAAATGGCGCCTTATGTGAAATCAAAGGTGTTTCTGCTTC
ATGCAGTCCTTTACGCGGTCTGGAGTATTTCTGTCACAGC
AATGAACGTGACGTGTGGCAAAGACTTCATTTCCATCCTA
GTGGACGAAGAGTACTTCAAATACTACAATGTTGGAGTAG
AAGCTGTTCATTTGCCTAACCCCAGGTGCCGTGCCCACAG
AAAAGAGATCTCTGGATCAACCTATTTCACCGTGCACACA
CCAATGGACCAGTATACAGCCTGTGGTGGCAAACCTCTGA
AGAAGAACATAACGCACGTTACATACTCCTTAACTCTGAT
GGCTGACCCACCTGTGTATGGAAACATTGTGAGAAATCCG
GCTCTGCAGATTGTGTACAAATGCGTCTATCCGTACATTC
GCAAACTCAGCCTGTCGTTTCCCATCTTCTCCTTCTCCAG
TGAAAGTTTGTTCAAGGTGGATGAAGTGGACGCCAGGGTG
GAAATGAGCTTGTTTAAAGATCTGACATACACTGAGGCTT
TCACTAGTGCTCCTACTATTAAGCTCGGGGATCAAATCTT
CGTCCAGATTCAAGTGATTGAGCCCGAAGATTTCTTCCAT
TTGAAAGTCAATGATTGTTGGGCGACTACGACTCCTCGAG
CTAATGATAAGTCAGGCCTAAGGCATACACTATTGGAGAA
CGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations