Transcript

gabra6a-201

ID
ZDB-TSCRIPT-090929-11379
Name
gabra6a-201
Previous Names
  • gabra6a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028945 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028945|OTTDARG00000022477|ZDB-GENE-040426-1692 gabra6a|OTTDARP00000023671 DKEY-217K23.1-001 LG_none CU062437.8,CR628344.5 Danio rerio protein_coding KNOWN, 2754 bp
CTAGTGTATCGGAGAGCGCTGTAAAGAAATATCAAACGGA
ATATACACCAAATAGCTAACTGTGGTGGAAAGCGTTTCTT
GTCACTGTAGAAACACCGACTGCTGTTTTTGGTTTGAAAT
GACTTTACTTTTTATTTATTTAAATCTAATTTACTGTCAG
AGAAGATCAATCTTCAGACTGGAGAAATGTTTAGGTTACG
TTGGTGATGTGTTAAGTGAAGCTGCAGAACTTTCAAGAAG
TAACAACTCGTTTATGTTCAGTTTGCTAGTTGAGCTACTT
TTTAACCTGTTGCTAAAAAAGCTAGTGGATTTCACTAATC
TCTTAATTTGATAATCCTCAAGCATTCACTTCACAGCATG
TAGGCCTACTGACAGTCATACATAGTGTAGCCTACAGTGC
TTCATTCCATCTGTAGTGCTTTATACAGTACATTATGACT
TCTAACTATTGACAGCTTCATTTATTTATTTAATTTTGGC
CACAGAAATGGCTCTACTTTTGGCCTTTTTATGTCTTACA
AGCGTTACAAATGTAATAGGAAAGCAAAAGATAAATTCAG
AAAATATAACAAGGATTCTAGACGGACTTCTTGAGGGCTA
TGACAATCGACTACGGCCAGGATCTGGAGTCTCTGTGACT
GAGGTCAAAACAGACATATTTGTTACAAGTTTTGGACCAG
TATCAGATGTTAATATGGAGTTCACCATGGATATGTTTTT
CCGCCAAATGTGGGTTGATGAGAGGTTAGCCTTTCAGGGG
CCCATTGAAATCTTGCCTTTGAATAACCGTATGGTGGACA
AAATCTGGACACCTGACACATTTTTCCGCAACGCACGGAA
GTCACTGGCACACAACATGACGTCCCCAAACAAGCTGTTC
CGAATCATGCAAAATGGCACAGTCTTTTATACCATGAGGT
TGACTGTAAGTGCAGTATGTCCAATGGTGCTGAGGGACTT
TCCTATGGATGGACACACATGTCCTCTCTACTTTGGAAGC
TATGCTTACACGAATCGTGAAATTGTCTACACATGGAGAA
AAGGACTAGAGGCATCTGTAGATTTTCCTCCAGAATCATC
AAGTCTTCTTCAGTATGATCTCCTGGGCCAGACCTTGTTC
ACCGAAACATATAAGTTCAGCACAGGACTGTATTCTGTCC
AGGTCGTCCATTTCTATCTTCAGAGGAAGCTTGGATATCA
TCTTATCCAAACGTATATCCCTTTGATTATGGTGGTGGTT
CTGTCACAAGTCTCATTCTGGATCAACAAGGAATCTGTTC
CGGCTCGAACGGTAGCTGGAATCACCACTGTGCTCACCAT
GACCACTCTAAGCATCAGCGCCCGCTCTTCCCTGCCCAAA
GTCTCCTACGCCACCGCCATGGACTGGTTCATCGCTGTCT
GCTTTGCCTTCGTGGCTTCGGCTCTACCTCAGTCTGACAC
CAGTGCCTATAGCCGTAAAAGAAGGGGTTACCCTGTGTCT
GAAGCGCCCAGGACTCGCGTACCCATCTTTCTTCAGGGCT
CAGCCTTCCCACCCAATATGATGCTGGCAGGCACCAGCGC
CATAGACAAGTACTCCCGCATCCTTTTTCCTCTGGCCTTT
GGGATCTTCAACCTCGTCTACTGGTACATCTATCTCAGCA
AAGACACTCTGGAAAAGCTCAGGGATATCGAGTGAGTTTC
TCCTGAGCAGCACAAGGCATATTCAGCAGTAAGACTTACA
GGAAGTGCTTTACTCTGGACCTCTCTTTCTCTGTCTCTCA
CTTTCGTCATCTTTCGTCAACTTCACCCTTGATCGAGCAC
AAGCCCGCCTGACACTGTTTGACAAGCATTTGATCCCGTT
CCTTTCCTATTTTATCACCTATATACTTTCCACTCCATTT
GCCTTTATATTCACAGATGTAGCCGAGGGCCACGTCGTTA
TACTAACCCTGCTACATTACAAACCTTCCTCTGGTTCTGC
TCTAGTTCTGTTCGTGTATGTGTGTGTATGTGTAACACAC
TAAGGAGTTGATGACATAATCTGCAGCTCTAACTGGTGAT
GCAACATTAAACCAATGCTTTCAGTGGCCTGCCCTCTACA
GAGACACGGCTCGCACTGCACTAGATCAAAAGCAGCGGGT
TTATACTGACAGCTTCAACGATTTCGCATTGAAAATAAAG
GAGAAAAAGTGCATCCCCAGAACTGAACTTTTACTAACAC
CATTCACACACCACACGGATGTATTGAGAGTACGGTGCTT
CTGTTGGTGCGGTCACGCTGAAATAGAGGGATAAAGTAAA
GCTCGGTGTGGGGGGTGCGTGTTTAATATGTATTCTCTGC
TCGCGGTTTATTTGATGTTCTCTGATGTTTCTCCGCCGTC
TCTGTTGGGAGAACATGCACATGCACAGGATGTACTCGTC
AATTCAAACAAATCGTAAGACTATTATGTTCAACATCATA
AATGGCTTTGAAAACCCATTTTGAAGAGACAATGTTGCAC
TGAAGAGTAAACATGCAGGTGCTAATGTAAACCTCAGGAA
ATAAATACATTAATTTGCTGACTTGTACTTCCGTTATGTG
CTTGCATATAATGTACTTGCCTATATAGGATATTTTTCTT
TATATATGGTTAACTGTTTGATGAAGTCCACTAAACATCG
AAAGATGTGTGATTACTGTATTATGGTGGAGAAAAATGAC
ACACTTTAGTACTGTATTTGTAAATAAAACTCAAATTATT
GGACTGTGTTTTACAATAAAATACTGTAATTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations