ZFIN ID: ZDB-TSCRIPT-090929-11331
Transcript Name: neil1-002
Previous Name: zgc:56361-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028895 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028895|OTTDARG00000022447|ZDB-GENE-040426-994 neil1|no_translation DKEYP-73B11.2-002 LG_ CR391977.5 Danio rerio protein_coding KNOWN, 677 bp
GGAGAATGTTCTTTCTAATCTATCTGACAAGGCATTTGAC
AAACCCATCTGTGAAGCTCTCCTAAATCAGAAGTATTTCA
ATGGAATTGGGAACTATCTTCGAGCAGAGATCTTGTTCAG
ATTACAAATCCCTCCATTTGAGAAGGCACGAACAGTTCTA
GAAGGACTTGAGCTGAAAGACGAAGATAAAAAGAAGGTCA
AAAAGGAGATTTCAGTTGCAGAGGTGAAGGAATCTGGCCT
TCCAGTCTGTGTCAGTGTATTATTAGGCACTTGGTTTGGC
ATAAATCATTGCTTTGTTCTGTATTAATCAGACTACAGAC
ACAACTGCGAAGAAGGAGATTAAGACTGAGACCCCAGACC
TCCTTTCGTTATGTCACACTGTTCCTTGGGAAGTAGTGAA
TTTGGGTTGGTTTACTTTGAAACCAATTATTATTAACTGT
TTTTGCACAAATGTACATGCTTAGCATTGTAAATTATGGT
ACATACATACATAACCATCATGGTTTAGATCAGTATTCAT
GCACTTCATTTCTTCATCATTAGGAGGAAAGGGTTATGCC
CCTGCAAAGGGGGAGTATTCTGTTCTACAGGCCTGGATGA
GGTGTTACTCTGTGGATGGAATGAACTCATTAAATGACCA
CAATGGACGGACAATTTGGTTCAAAGTATGAGCTTGT

neil1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA neil1-201 (1)    Ensembl 1507
ncRNA neil1-002 677
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
neil1-002 Contained in:
[BAC] DKEYP-73B11 (1)

Genome Resources: Vega_Trans:OTTDART00000028895 (1),  Ensembl_Trans:ENSDART00000124123 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO247279 (1) 900 nt
CITATIONS (2)