Transcript

rnf103-201

ID
ZDB-TSCRIPT-090929-11284
Name
rnf103-201
Previous Names
  • rnf103-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028843 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028843|OTTDARG00000022413|ZDB-GENE-040912-171 rnf103|OTTDARP00000023589 CH211-2M15.4-001 LG_ AL929267.15 Danio rerio protein_coding KNOWN, 3116 bp
CAGCTGATCATCAGGCAGAGCTATCAGACAACACTACTCA
GACGCACAGAAACCCCAACATTCTCCAGAATCGCGAATAA
ACTGTCGTTTTCGCTGCACGTGAAGTCAAATATGTCGGGA
CAGTAATTTTTAAAATAAAAGAAGACAGCTGTTTTTACGA
GCTTTTATGCGCAACACTGGGGACCAAAACACATTGGCCT
GCTAAAGGTCTCTTTTCTGAAGGTGTTTGTATGCGGTTGT
TTTGACGCGCAGCCTCCATATAATTGTAATATGCGATGAA
AACGATTCTTTTCAGCTTTGAAAGTCATTTGTTGCACGGT
TTGCCTCTAGACGTATAAAGGAGCGCCAGTGCCTCAAATT
ACTGGACTTTCAATGCAAATCAGCTAGCTCACAGCGAAAA
CTTCCTTCTGCGAGAAAATGTGGTGGAAACTCTTCTTTTT
GCTCCTTTATTTTTTCATTTTATTCATTTTGGCTCGTTTT
TTTGAAGCCATCGTCTGGTATGAAACAGGAATTTTCGCCA
CCCAGCTGGTGGATCCGGTGACACTGAGTTTTAAGAAACT
CAAGACCATCCTGGAGTGTCGTGGACTGGGATACTCCGGC
CTGGCAGAGAAGAGGGACGTGAGGGAACTGGTGGAAAATT
CGGGGGAGCTGATGCAGGGGGAGCTTTACTCCGCTCTTAA
GAATGAGAAGGAGCAAGCAGGATCTGACTCCAGTACCACT
TTTAGTGGAGAAATGCACTTTTATGAATTAGTGGAAGACA
CAAAAGATGGTATATGGTTAGTCCAGGTAATCGCCCAAGA
TAGAAATCCACTGCTGAGCACTGCCAACTGGGGCAAAATG
GTACAGAAAGTTTCTCAGTTTGGCATTCGAACAGGCACTT
TCAACTGCTCAAGTGACTCAAGGTATTGCCATAAGCGGGG
CTGGATGAAGTCTACCCTAATCATGTCTGTCCCACAGACC
TATGCCTCCAAAGGGAAGGTCATGTTGAAGGAGTACAACG
GCAGACGCATTGAAACAGAGCACATATTTAAATGGATGAC
TGCGCATGTCGCCTCTCGCATCAAAACAGTCCGTTACTCC
GATCAATTAATGGACGACTGGTATCAAATGGAAAAGCAAC
CAGTAAAGATGTTCTTATTTGCCAGACTGCTTCAGCCTCC
TGCGTTCTTCTCAGCTCTCAGCATTAAATTCACGGGCCGC
ATCGAGTTCATCTTTGTTGATGTGCGCAACTGGGACAACA
ACACCTGTTTGGAGGAAATTGGGGTGCAGCAAATGCCCTC
ATATATCCTCAAAACACCAGAAGGCATCTACAGATACGGC
AATAGCACTGGGGAATTCATCTCCTTGCACGCCATGGACA
CATTTCTTCGCTCCGTGCAGCCAGAAGTCAATGACTTGTT
CATTTTGAGCCTGGTCATGGTCAATCTAATGGCTTGGATG
GACCTTTTCATTACGCAGGGAGCCACCATAAAACGCTTTG
TGGTTTTAATCAGCACTTTGGGCACTTATAATTCCCTACT
TATCATTTCCTGGCTGCCAATCCTTGGTTTTCTGCAGCTT
CCATACTTGGATAGCTTCTACGAATACAGTTTGAAATTGT
TGCGTTACGCAGACACCACTACTATCGCCTCATGGGTCCG
GGCAGACTGGACCTTCTATTCTTCTCATCCAGCTCTCTTC
CTCAGCACTTATCTAGCCCATGGCCTTCTCATCGACTACT
TCGAGAAAAAAAGAAGATGTAGCAACGAAGACCAAAATGC
AAACAACCTAGAGTGGCTGTCAAGTCTTTGGGATTGGTAC
ACCAGCTACTTGGTACATCCTATTGCCTCTTTCCAGAACT
TTGAGTCAGACTGGGATGATGATCCTAATTTCCTTTTGGA
AAGGTTGGCATTCCCAGATCTCTGGCTTCGCCCACTTGTT
CCGATAGATTACATCAAGAACCTGCCCACCTGGAAGTTCA
GACTCCTACAGCCTGAAGGCTCCAACCTAGCAGACCGCGA
CAAACGGCAGAAAGCCATGATGAACCAAAATGAGGACTCC
AGTGGGAACAAGGTAGCGCATCAGTGCAGTTCAGACGTTC
TACATGATCATTACGGGTGTTCAGCTGCAACCAAGTCAGA
AGAGAGTTGGTCTGGTGGAGAGGAACAGGACACTGATTGG
TCTCAGTGGCCTTGTGGTATGCTTCACTGCACAGAGTGTG
TCGTATGTCTTGAGAACTTTGAAACGGATTGCCTTGTCAT
GGGTCTACCATGTGGCCATGTTTTCCACCAGCAGTGCATC
GTGGTCTGGCTGGCTGGAGGGCGGCACTGTTGCCCAGTGT
GCCGGTGGCCATCATACAAGAAGAGACCCGTACGACAACG
TGCAACTGAACAACTCGATCCAGAATAGCCCATGCGTGAT
TCATTTACGTCTTGCTTCCTGCACTTATTTAAAAAAAGGA
AAAACATGACTTGATGTGTCCATCTTTAGTCTATAGATTC
ATAACATGGGTTCCTGGGGTTTTTGTTGGTGGTTTTAACT
TGCACAGTCATTAATTAAATTCATACTTCCCAATATTTTT
CAATAAAATTAAAAGAAAATGCTAATTTATGCAAATTATA
ACATACTTAATGGTAGATTCAACACACATAGTTGAAAAGC
TTCTGTTTTAGCGCCCACACATCATACATCCCAATAAAAC
AAAAGAAAAATCCATATGTTCCTGTACCTGAGAATCACAG
TTTGTGTTCAGTGTGTTTCCAAATGTGAGTAATCTGTCTA
AAATTAATCGGGGAGAATAAGATTCTAGGAGATGTGAGCC
TTTATATAAGGTTTACCCTCTGGGCATGTAAATATGATTT
AATTTTTTTTTGTAAGGAATTACAGCTTTACATTACTTGA
GTAAAACGGCCCTGTGCAATTGAAAATGGCTTAGGCACTG
AAATGCAATTAAAGGCTCCATCTTCAAATAAAGTTGTCTT
GTTGGAGCATGTTTTGTTATTTTTAACAGCATTTTGCCAT
TAACACTAATAAAGACTTTACACTTTGACGTTTGCTGTTT
GTCAGGGTGTAAAAGTAATTTGGGAACCTTTACCTGTAAT
GACATTAAAATTCAATAAAGTCCTGCTTTCTCACCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations