Transcript

cpa2-201

ID
ZDB-TSCRIPT-090929-11201
Name
cpa2-201
Previous Names
  • cpa2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028756 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028756|OTTDARG00000022353|ZDB-GENE-040801-182 cpa2|OTTDARP00000023513 cpa2-001 LG_ CR376785.10 Danio rerio protein_coding KNOWN, 1341 bp
GACAGTGGAGATCATTTCTACAACTGGAGAACATGAGACT
TTGTATAGCAGTCTTTGTGCTTTTGGTGGCTGTTCATTGT
GAGGAGCTCTTTAATGGAGATCAAGTTCTCAGAATCCATG
CAGAATCTAAAGACCACATCCAAGTCTTGAAGGAGCTGGA
GAAGGATTCAGGGCTGGATTTCTGGACTCATGGCTTCTCT
ACTGAACGTCCTGTTGATGTCCGTGTGCCTCATGCCAGTC
TGTATGCCGTCAAAGATTTCCTGAAGGAAAACAACATCTC
TTTCTCTGTCATGATCAACAATGTTCAGGAGCTTTTGGAC
AGGGAGAGAGCAGAGATGGTTAGTAACACGGAGATGGAGC
GCAACACCAAGAGCTTCAACTTTGCTGCTTATCATGATCT
GGATACTATTTACAGTTTTATGGACACCCTTGTTGCGAGT
CACTCTAATCTGATCTCGAAAGTGAAGATTGGCAGCACCT
ATGAGAACCGTCCCATGTATGTCCTGAAGTTCAGCACTGG
TGGAGAGAATAAACCTGCGATCTGGATTGATGCTGGGATT
CATGCCAGAGAGTGGGTTTCTCATGCATCTGCTGTGTGGA
TCGCTGACAGGATTGCCACAGACTTTAAGGAAAACCGTGC
TCTTGCTCGCAATGTCCTTAGTAAAATGGACATTTACTTG
ATGATTGTGGCCAATCCTGATGGATACGTCTTCTCCCACC
TCACCGTCCGGCCGTTTCACCGTTTGTGGCGTAAGAGCCG
GTCTGTGACCTCTAACCCAAACTGCCCTGGTGTCGACCTC
AACAGAAACTTTGATGCTGAATTTAGTGGTCCTGGAGCCA
GTGATGACCCATGTGCTGAAGACTATCGCGGCCCTTCTGC
TCATTCAGAGATTGAAGTGACGAACATTGCGGATTTCATT
TTGAGCCACGGCAACTTCAAATCCTTCATGACCCTCCATG
CTTATTCTCAGCTTCTAATGTATCCCTACGGCTACACCGG
CTCAAATGCTCCTGACCAGCCTGACCTTCATGATGTGGCC
ACTCAGGCGAACAAAGCCCTCAATTCTTGGCATGGCACCA
TTTATAAAGTTGGAAGCATCTTCCACACTATTGAGCAAGC
TAGTGGTGCAAGTGTGGACTGGGCTTACCAACATGGCATC
AAATATTGCTTCGCTTTTGAGCTGCGTGACACTGGTGAAT
ATGGATTCCTCCTGCCCGCTGACCAGATCGTTTCCACTGC
AAGGGAGACATGGTTTGCTCTCAGATACATAATGCAATAT
GTTTCTGATCATCCTTATTGAGATAAAGCTACAATAAAGT
TTCCATAGAGATAAAACTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations