Transcript

tmem147-201

ID
ZDB-TSCRIPT-090929-11178
Name
tmem147-201
Previous Names
  • tmem147-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028726 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028726|OTTDARG00000022335|ZDB-GENE-040718-187 tmem147|OTTDARP00000023488 CH211-240E14.2-001 LG_ BX511252.17 Danio rerio protein_coding KNOWN, 1113 bp
GTATACGTTCGGACCTTTATCAGTGATGCACCGGAGGATT
ATGTGACCCTGCGCCTGTCATTCCAAAATCACAAATTTGT
TGAATCAGAAGAATATCACAGTGAAATCTCCACCATGACT
CTTTTTCATTTTGGAAACTGTTTTTCTTTGGCATATTTCC
CATATTTCATTACATACAAATGCAGTGGATTATCTGAATA
TAATGCATTTTGGAGATGTGTCCAAGCAGGTGCTACATAC
CTCTTTGTGCAGCTGTGCAAGATGCTGTTTCTTGCCACAT
TTTTCCCCACCTGGGAGGGAGGAGCCGGTGTTTATGATTT
TGTCGGGGAGTTCATGAAGGCCACAGTAGACATGGCTGAT
CTTCTAGGTCTTCATCTGGTCATGTCCAGGAATGCTGGGA
AGGGTGAATATAAGATCATGGTGGCAGCGATGGGCTGGGC
CACAGCTGAGCTCATCATGTCCAGATGTATACCATTATGG
GTCGGAGCTCGCGGCATTGAGTTTGACTGGAAATACATCC
AAATGAGCTTCGATTCCAACATCAGTCTGGTACATTATAT
TGCGATGGCAGCAGTAGTGTGGATGTTCACTCGATATGAC
CTTCCCAAAAGTTTCCGCCTCCCTGTTGCCATCCTGCTGG
GACTGTGCGTTTACAAGGGCTTTCTCATGGAGCTGTTTGT
TCATGTGTTTCTGTTGGGCAGCTGGACGGCTCTCCTCGTG
AAGGCTGTGCTCACCGGTGCCATCTCTCTCTGTTCTCTTT
TCCTGTTCGTCACACTCGTCCACAGCAACTAAAGGCTGCC
AACACACTACAGTTCAAGTATTTACAGAGCAAAACCCACA
TTCCTAGAGTGAATACTGTCGACTGTATCTGCCATACCAA
AAGGAGGCTGTGAGATTATTACTGTTACTAGCGAACTTGG
ACAGGAATGCACGGGGCAGTTTTGGGAGAAAATCCTAGTG
GTGTAACAGAGATACTCTGAGAAAGATCTTTTTTTAATGA
CAAACTAATTTATAAATGTAGACCAGATGGGAATAATTCT
TTGGCTTTTTTTGTATGGTAGTGTTTAGTTATCATGAATT
AATAACTAAATAAACGGACACCATATTGATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations