Transcript

taar10c-204

ID
ZDB-TSCRIPT-090929-1117
Name
taar10c-204
Previous Names
  • taar10c-001
  • si:dkey-7c18.10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007979 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007979|OTTDARG00000007091|ZDB-GENE-041014-57 taar10c|OTTDARP00000007051 taar10c-001 LG_ AL929507.37 Danio rerio protein_coding KNOWN, 1012 bp
AATGGACATCCGGATAAACTTCAACCAATCTGAAATATTG
GAAAAGCCCTTCCTCTGTTATGAGTTCAGTAACAGGTCTT
GCCAAAAGTTTGTTCATACATTGGAAACGCGAATATTGTT
CTACATTCTTCTTAGTGCCTCTTCAATAATCACAATCATA
GGAAACCTGCTGGTGATCATAACAGTCGTTCATTTCAGGC
AGCTTCACACACCGACTAACTACCTCATCTTGTCTCTGGC
TGTGGCCGATCTGCTTGTCGGAGGAGTTGTGATGCCTCCC
AGCATGCTGCGCTCCATCGAGACCTGCTGGTATCTGGGAG
ATTTGTTCTGTAAGATCCACAGCAGTCTTGATGTCACATT
GTGCACCGCTTCAATCCTAAACCTCTGCATCATTTCTTTA
GACCGATATTACGCCATATGTCACCCGTTCCAATATCACA
GTAAAATGACGTCGCTTGCCACATTGGTTATGATTATCAT
CTGCTGGACTGTTTCGGCTGTTCTGGGCTTTGGCATGATC
TTCATGGAGCTGAATATTCTCGGTGTTGAAGATTTTTACT
ATGAGAACATTAAATGTGATGGAGGATGTACACTTTTTCA
GAGTAAAACCATAGCAATTGTGTACTCACTGATCTGTTTT
TATATTCCTGCTTTAGTCATTCTCTGTGTGTATCTTAAAA
TCTTACATGAAGCTCAGCGGCAGGTTCAGGCCATCCAGAG
TGTGAATTCTGAACTGAAGAAAGAGGGAAAAGCCAATAAG
ACTTTAGCCATCATCATTGGAGTGTTTCTGACTTTGTGGG
TTCCTTTTTTCCTCTGTAATCTTATTGATCCATTCATTGG
TTACTCTGTTCCTCCACTGCTGTTTGACTTGTTCTATTGG
ATTGGATATTATAATTCCACCTGTAATCCAATAGTGTACG
CCTTCTTTTACAGCTGGTTCAGACATGCTTTCAGAGTCAT
TCTGTCCAAAGCAATATTTCAGACAAATTCTTCAAGAACT
GTGCTGTTGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations