Transcript

taar10a-203

ID
ZDB-TSCRIPT-090929-1116
Name
taar10a-203
Previous Names
  • taar10a-001
  • si:dkey-7c18.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007978 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007978|OTTDARG00000007090|ZDB-GENE-041014-55 taar10a|OTTDARP00000007050 taar10a-001 LG_ AL929507.37 Danio rerio protein_coding KNOWN, 1012 bp
AATGGATGACCATATCAACATCAGCCAAACTGAGTCCTGG
GAAAAGCCTCTTCTCTGTTATGAGTTTAGTAACAGGTCTT
GTCAGAAGTTTGTTTATCCTTTGGATACTCGTATATTGCT
ATATATGCTTTTCAGCATCTCTTCAATAATCACAATCATA
GGAAACCTGCTGGTGATCATAACGGTCGTTCATTTCAGGC
AGCTTCACACGCCGACTAACTACCTCATCTTGTCTCTGGC
TGTGGCCGATCTGCTTGTCGGAGGAGTTGTGATGCCTCCC
AGCATGCTGCGCTCCATCGAGACCTGCTGGTATCTGGGAG
ATTTGTTCTGTAAGATCCACAGCAGTCTTGATGTCACATT
GTGCACCGCTTCAATTCTAAACCTCTGCATCATTTCTTTA
GACAGATATTACGCCATATGTCACCCGTTCCAATATCACA
GTAAAATGACGTCGCTTGCCACATTGATTATGATTATCAT
CTGCTGGACTGTTTCGGCTGTTCTGGGCTTTGGCATGATC
TTCATGGAGCTGAATATTCTCGGTGTTGAAGATTTTTACT
ATGAGAACATCAGATGTGATGGTGGCTGCTTTGTGTTTCA
GAGTAAAACCGGAGGTACTGTGTTCTCACTGATCTGTTTT
TATATTCCTGCATTTGTCATGCTCGGTGTGTATCTTAAAA
TCTTACATGAAGCTCAGCGGCAGGTTCAGGCCATCCAGAG
TGTGAATTCTGAACTGAAGAAGGAGGGAAAAGCCACTAAG
ACTTTAGCCATCATCATGGGAGTCTTTCTGACATTCTGGA
TTCCCTTTTTCCTCTGTAATCTCATTGATCCATTAATCGG
CTACTCTGTTCCTTCACTAGTCTTTGACTTGTTCCTGTGG
GTTGGATATTATAATTCCACCTGTAATCCAATAGTGTACG
CCTTCTTTTACAGCTGGTTCAGACATGCTTTCAGAGTCAT
TCTGTCCAAAAGAGTATTTCAGACTAATTCTTCAAGAACA
ATATTGATGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations