Transcript

dusp11-201

ID
ZDB-TSCRIPT-090929-11119
Name
dusp11-201
Previous Names
  • dusp11-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028646 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028646|OTTDARG00000022285|ZDB-GENE-050417-226 dusp11|OTTDARP00000023421 dusp11-001 LG_ CR925773.4 Danio rerio protein_coding KNOWN, 4992 bp
GAGCGCCGGCAGCGGCGCAGCCAGCGAGGCACACTGTAAC
GTGGAAGAGGAGCAATCTCAGAGAAGTGTATGGCATTGAG
AAGCACTGAACAGCTGAGAAAACATGGCTCCAAATAAGAA
AAATGGCGTTCCTGACAGATGGACTGACTACACATCATTA
GGTAAACGGATACCTGGTACACGATTCATCGCCTTTAAAG
TTCCCTTAAAACAGTCTTTCAGACGTCATTTATCAGAATC
AGAAGTCTTTGGCCCGTTTGATCTGGTGCGTTTGTTGGAG
AAGGAAAGACAGCAGCTGGGTCTCATCATCGATCTGACCT
TCACCACCAGATACTACAGAGCAGAGGATTTGCCAGATAC
GCTGTACTACATGAAGATCTTCACAGCAGGGCATGAAGTG
CCAAATGATGCCACCATTCTCAGCTTCAAGAAGGCTGTTA
GACATTTTCTGCATGACAATGCAAGCAATGATAAGCTGAT
TGGTGTTCATTGTACACATGGTTTGAACCGCACCGGTTAT
TTAATATGTCGATACCTAATCGATGTCGACGGGATGATGC
CGCAAAAAGCAATTAATTTGTTTAATGAATCAAGGGGACA
CTCGATAGAGAGGCAGAACTATCTTCAAGACCTGACCACG
GGGCCCAAGAGAAGTAATAATGGGATGGATGAACCCGACC
AAGAGCCTGTTCGGGGGCTTGCGAATCTGGCGCTAAACGA
GGCTCCTTCTCATCAGCGGGAACTGAATAACTACAATCAG
AGATCATACGAGCGGCACAGGGACAACCGGGAGGACTTTT
TCCCGTTTCACCAGAGAAACAGCATGCCTCGGTTTGGGCC
TCCAGAACATCAGTCTTTCCGTCCGCCACCGTTTACTCAT
CCACCACCAGAAAGAAGATCTTATTATCCCAACCAGAGCC
TCAGTGGATTTCACTGCAGTCCTTCAAACCAGTATCCGCC
TCCGTTTCCCTCTTACAGGTTTGGAGAACCGTACCATCAC
CCATATTTACCTGCGCCAGAGCCCACGAGACCTCCAGGAT
CTCACCGCAAACATCGGCATCGATATAGGAAGGACAAAAC
ACATCGCTGAAAAGGCAGAAAATGAAGCTGGTGTCTAAAA
GAGTTGTGGTTTATTGAGCTCTGCCAGCTGATAACACTTT
CTTTTATATTGGGTCATTTTATGCAGCAAATGCATATATT
AGAGTCAAAAAGATAAACTACTTGGTTAAAATGAGCTGAA
ACAACACACTATTTATAGTTTTCTTTTGTTTTTGGGACAA
CTTAATTGTTTTAATTTGTAAACAATTAAGAGTAACACTT
TACGCTGGAATTAATGCTGGGTTCCACACAATTCCATCAT
GTTTTCCAGACACAAGCCTAGTTAACTCTAGTTTTTACAC
CTTTAAGTCGATTGAACATTAAAAAATTAAGTTGTCCCCC
TAAAAAAACTTATTTTAAATGAGTAGTTTAAACAAGTAGC
CATATTTTGTGTAGAATAATGGTCCATTAGTTAACTTTTA
ATGTATTTACTAACATTAACTTGGTATAAATGATCTTGTA
AAGCATTTGTTAATCATAGTTTAACATTTATTAATGCATT
ATTGACATCAAAATTCATGCTTGTTCTCATTAGTTAATGC
ACCAATGTGAGTTTACATGATCTAAAGTTATTTAACTTGA
CGTTAACAAAAGTTAAACAAATGTATTACTAATTGTTTGT
TCCTGTTCGTAAATACATTAACTAATAGATCATTATTTTA
AAGTGTTACCCGAACTTAATTGATTTGTGTTGGGACGACG
TGAATTGTGTGGAACCCAGCATTTATTTTACACTAAAATA
TATATATATATATTCCTGCATGTTCAAACTACTAATTTAA
AATGAGCTTAAACAACACAATTATGGAGATTTATTTTGGC
GAGGAAACTTATTTTTTTTTATGTTCAATCCACTTAAATT
TGTTATGTTGCTTTTAATGGATTTGTGTTTGGACTAGTGT
TGTCATGATACTGAAATTCGGTACCAAGCGATACTGAAGT
TTTAAAAACGTGCATTTCCCGCTAATATTTGAGCACTGTT
GAGCACCTTCCTAAACAGCGCTGATTCGCCATTGTGTTCT
CGTGCTCAACAGTAATGACTGTGATTGGCCGTGAAGCTCA
TCAGTTCATCGAACTCACTGCTGTTTACTGAGTGTAGCCA
CAGATACAGGGACACTGGAGCATTTTAAAGCAGCGATTCA
TCAGCGGATCGCTCATATGTCAGCTTATAGACAAACCAGC
TGATTGACATTACTTTAAAATGCAAATCAGCGCTTTTTAG
GAATGTGCTCAAATGTTAGCAGGAAATGGAGGTTTATAAA
ACTTTTGTATGGATCGGTATCGAATTTCAGTATCGTGACT
ACACTAGTTGGGACAACATGAATGTATTAGTGTTGTCACA
ATACTGGAATACGATACCAAGCGATACTGAAGTTTTAAAA
ACCTCCATTTTCCGCTAATGTTTGAGCGCTGTTGGGACGT
TCTTAAACAGCACTGATTGGCCATTGTGTTCACATGCTCA
ACAGTAATAACTGTGATTGGCCCCAAAGGTCATCAGTTCA
TCGAACTCACTGCTGTTTTTCTGAGTGTAGCCACAGATAC
AGGGACACTGGAGCATTTTAAAGCAGCGATTCATCAGTGG
ATCGTTTGTAAATCAGCTTATAGTCAAACCAGCAGATCGA
CTTTACTTTAAAATGCAAATCAGCGCTTTTTAGGAACGTG
CTCAAATGTTAGCAGGCAATGAAGGTTTTTAAAACTTCTG
TATGGATCGGTATTGAATTCCAGTATCGTGACTACACTAG
TTGGGACAACATGAATGTATTAGTGTTGTCACAATACTGG
AATTCGATGCCAAGTAATACTGAAGTTTTAAAAACATCCA
TTTCCCGCTAGTGTTTGAGCGCTGTTGGGACGTTCTTAAA
CAGCGCTTATTTGCCATTGTGTTCTCGTGCTCAACAGAAA
TGACTGTGATTGGCCGTGAAGATCATCAGTTCACCGAACT
CACTGCTGTTTACTGAGTGTAACCACAGATACAGGGACAC
TGCAGCAATTTAAAGCCTTGATTCATCAGCGGATCGCTCG
TATGTCAGCTTATAGACAAACCAGCTGATCTATGTGACTT
TAAAATGCAAATCGGCGCTGTTTAACAACGTGCTCAACAG
CGCTCATGTTATCAGGAAATGGAGGTTTTTAAAACTTCAG
TCTCGATTGGTTCCGAATTCCAGTATCGTGACTACACTAG
TTGGGACAACATGAATGTTTTAGTGTTGTCACAATACTAG
AATTTGACACCAATCTATATTGAAGTTTTAAAAATTTCCA
TTTCCCACTAATATTTGAGTGCGTTCTTAAACAGCGCTGA
TTCGCTATTGTGTTTACATGCTCAACAGTAATGACTGTGA
TTGGCCGAGAAGATCATCAGTTCACCGAACTCACCACTGT
TTACTGAGTGTAACCACAGATACAGGGACACTGCAGCAAT
TTAAAGCCTTGATTCATCAACGGATCGCTCGTATGTCAGC
TTATAGACAAACCAGCTGATCTACGTGACTTTAAAATGCA
AATCAGCGCTGTTTAAGGACACGCTCAACAGCGCTTATGT
TATCGGGAAGTGGAGGTTTTTAAAACTTCAGTATCGATTG
TTACTGAGTTCCAGTATCATGATTACACTAGTTGGGACAA
AGTGAATGTATAAGTGTGGTCACGATACAGCAATTCTATA
CCAATCGATACTGAATGTCTATTTCCCGCTAACATTTAAG
TGCTGTTGAGCACGTTCTTAAACATCAGTAATAACTGTGA
TTGGCTGTGAAGGTCATCAGTTCACCGAACTCACCGCTGT
TCACTGAGTGTAGCCACAAATACAGGAACACTGGAGCATT
TTAATGCCACGAAGATCAGCTGGTTTGTCTATAAGCTGAC
ATACAAGTGATCCGCTGATGAATCAAGGCTTTAAATTGCT
CCAGTGTACCTGTATCTTTGGTCACACTGTAAACAGCGGT
GAGTTCGGTGAACTGATGACCTTCAAAGCCAATCACAGTC
ATTTCCCTTGAGCATGTGAACACAATGGCCAATCAGTGCT
GTTGAAGATCGCGCTCTAATGTTAGCAGGAAATGGACATT
TTAAAAATCTCAGTATGGATTGGTACTGAATTCAAGTATC
GTGACAACACTAGATTGCGTTGTGTGGAACCCAGCTAACT
TACTCGTTCTATGCCCAATACACTTAAACAATTAAGTTTT
AACTTGGACTATTTATGTAGGGACAACATGAAGGAATTTT
GTGGACCCCAGCATTTATTTACAGTATCTAAATGCGCTAA
CACTTTACAATAATAGTTTATTAGATGGTATATTTAACAA
ACAATGAACATTACATTTATTACATTGATTATTTATGTTT
GTTAACAATAATATAGTTGTTTGTGATCGCTGACAGTGCG
TTAACTATAAAATATTGTTCTTGTTAACTCAAAGTTCATT
AATTATTGTTAACAAACATGACTTTAGATTTTAATGATGC
ATTAGTAAATGATTAATAAATGCTGAATTGTTCTTGTTAG
TAAATACATGAACTAATGGAAGCTTATTGTAAAGTGTGGC
CATAAATGCTGCAGATCTGTTGTCATTTGTATTTAAGCTC
TCAGAGGTAGACAGTGAATTTTTATTAAGTGTTAAAGGGC
TTGTTTTTATTAATTCTGTTTTTATTTTGTGAGCTGATTT
GGCCTTTAGCTTAACTTGAGCAGGCTGAAACTGGAAATTG
GGCAGCCGTTTTAAATTTGAAGGAATTATTAAACTCCATT
GCAAGTGCAATTACAGGTTTTGTTTTATTGTATTTTGTAC
ACCTAATTATAAATCAGCTGAGATACTCGAGCTGATGCGT
GTTTTATTAATTTAGCGTGGTGCTCAGATGTTCCCGGATT
GAGATGAAATTAAAGGTTTATATTCAATTCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations