header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11038
Transcript Name: pon3.2-201
Previous Names: pon3.1-001, zgc:112374-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028552 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028552|OTTDARG00000022226|ZDB-GENE-050522-353 pon3|OTTDARP00000023343 DKEY-56F14.2-001 LG_ CR848666.4 Danio rerio protein_coding KNOWN, 1132 bp
GCCAGTGTCAGTCAGTATGGGTAAGTTAGCAGTTCTGTCG
TTAGTTGCTGTTGCTCTGGCAGTTTTCATCGGAGAAAGGC
TCGGCACACTTAGACATTTAACGCTCTCCCACAGAGAACT
AACCAAGAATTACCTTCCTAACTGCCAACTAATTAAGGGC
ATTGAGTTTGGGGCTGAGGACATCACCATTCTTGAAGATG
GATTGGCTTTTCTGAGCACTGGCTTGAAGTATCCAGGTTT
ACCATCTTATTCAGAAGACCCTGGAAAGATCTATACCCTG
AATCTGTTGGATTTTAAACCCAAAATCGAATCACTGAGCG
TCAAAGGAGACTTTGACAAAGACTCTTTTAATCCACATGG
AATCAGCGTGTACATCGATGACAAAGATGGTGCAATATAC
CTATTTGTTGTTAATCATCCTCAAGGCAAAAGTCAAGTGG
AGATTTTCAGATTTTTTGATCATGAAAATGCCCTTAAACA
CATCAAAACCATTAAGCATGAACTACTACATAGTGTGAAT
GATATAGTGGCTGTGGGAACTGAAAGCTTTTATGCCACCA
ATGATCATTACTTCACCAATGACATTCTGAAGTCTTTGGA
GCTGCTTTTTTCTTTGCCGTGGTGTGATGTGGTTTATTAC
AGTCCTGAGACTGTGCAGGTTGTGGCAGGAGGATTCTTAT
CTGCCAACGGCATAAACATCTCTCCTAACAAAAGGCATCT
GTATGTGTCAAATATCATGAAGCACAAAATTACAGTATTG
GAAATACAGAAAACCACTGAACTGTCTCACGTAAAGGAAG
TTGATGTGGGATCACTCTGTGATAACATTGAGGTGGATCG
TGAGTCTGGAGATTTGTGGCTGGGCTGTCATCCAAATGCT
TTCAAATTCTTTCTTTGTGATCCAAATGATCCGGCTGGCT
CTGAGGTAATCAAGATTGAGAACATCCTCTCTGAAAAGCC
TAGAGTGACTCAGGTGTATTCAGATGACGGAAGTGTGATC
ATCGGCTCATCAGTGGCGGCTCCATATAGAGGAAAACTGC
TCATCGGAACAGTTTATCAGAAAGCTCTTATCTGTGACCT
TAAATAGTGATACTTACAAATGAACATTAATAATAAAAAT
TCTTTGAAAGAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pon3.2-201 Contained in:
OTHER pon3.2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028552 (1)
  • Ensembl_Trans:ENSDART00000012807 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC095793 (1) 1148bp
    GenBank:CB356643 (1) 475bp
    CITATIONS (2)