header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11037
Transcript Name: pon1-201
Previous Names: pon1-001, zgc:91887-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028551 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028551|OTTDARG00000022225|ZDB-GENE-040912-6 pon1|OTTDARP00000023342 DKEY-56F14.3-001 LG_ CR848666.4 Danio rerio protein_coding KNOWN, 3791 bp
CACTGATGTTTCGTTTTTGTATTGATGAACTGTATTTGAG
TGTTTCAGTCAGTCAGTATGGGTAAGTTAGCAGTTCTCTC
GTTAGCTGTTGTTGCTCTGGCAGTTTTCATCGGAGAAAGG
CTCGTCACACTGAGACACGTAGCGCTTTCCTACAGAGAAC
TAACCCAGAATTACCTTCCCAACTGTCACCTAATAAAAGG
CATTGAATGTGGTTCTGAAGATATCACCATAATTGACGAT
GGACTAGCTTTTCTGAGTACGGGTGTGAAGGCTCCAGGTT
TACCATTCTGTTCAGATGACCCTGGAAAGATCTACACACT
AAATCTGTTGGATTCTGAACCTAAAATCAAAGCACTGAGC
ATCAAAGGAGACTTTGACCAAGACACTTTTAATCCCCATG
GAATCAGTGTGTACACAGACGACAAAGATGGTACCATGTA
CTTATTTGTTATTAATCATCCTCGAGGCAACAGTCAAGTG
GAGATTTTTGAATTTGTTAAGGATGAACATGCTCTTAAAT
ACATCAAGACCATCGAGCATGAGCTGCTGCACAGTGTGAA
TGATATAGTGGCCGTGGGGACTGAAAGCTTTTATGCCACC
AATGATCATTACTTCTCTAATGAGATTCTGAAGATTGTGG
AGAATTTCTTCACTTTGCCGTGGTGTGACGTCATCTATTA
CAGTCCTGAGACTGTGCAGGTTGTGGCAGATGGATTCTTA
CTTGCCAACGGCATAAACCTCTCCCTTGATAAAAGGTATT
TGTATGTGTCAGATGTTCTGAAGCACACAGTTACTGTGCT
GGAAATAAAGAAAAACACTGTGCTGTCTCGTGTCAAGGAG
ATTAATGTGGGCTCACTCGCTGACAACATAGAGCTAGACC
GTGAGTCTGGAGATCTGTGGATTGGTTGCCACCCAAATGG
TTTCAAGTTCATGCTTGGTGATCCAAATGATCCACCTGGT
TCTGAGGTAATCAAGATTGAGAACATCCACTCTGAAAAGC
CTCTGGTGACTCAGGTGTATTCAGATAATGGCAGTGTGAT
CATTGGTTCATCAGTGGCAGCTCCATATAGAGGAAAAGTG
CTCATTGGAACAGTTTATCACAAAGTTCTCCTCTGTGATC
GTAAATAGTAGTGGTGTAACGGATCACAAATCTCACAGTT
CGGATCACACTGCGGTTTTTGAGTCACTGATCAGACCATT
ATGTCGGATGAGCAAAAAAGGGAGAAGACGAATGTCATTT
GCTTTCCATTTATACAGAAAATAAAACTGCCGTGGTTTCA
ACAAACAAAACGTAGAACATGTCATTTTAATAAAAATAAA
AATAGAATTTATATCGAATTTTTACTTTATAGAAATAAAG
AACCACCCCCTAGTAAACAGTAATAAAACTCCCTAGGATA
GATAATTATAAAGATTTAATTTGGATTGTGTGTAGTTTTA
TACACTTTTTTTGTGACAAACAAATTAAAGATGTCATGCT
ACTTGTATTTTTGTGTTAGATCTGAAATATCAGCTTGTGC
TAAATCATTCATGGTATTCTTAGTAAATGTTTATTTGGAA
CAGGCACAATGTTTTGTGCCTGGAATCAATGTTTCTCAAC
TATCATAAGTACAAGGATCTATCTGGGTAGATGAAGTACA
GTTGAATGTTTCCAAAATGTCCGGAATGGCTCTTCAATGG
CACTAGCATTCTTAAGACCAAGGGAGTCTATCCAAACCAT
GTCAATATGAATGATATTAGAGTTGGGTTGATTCAGCAAT
TGGAAGTGTCATAATCATGTTTTTGATGATAAAGAATGTT
AGTATGCCAAAGACCTTTTTATCTTAAAGAACAAAATAGT
CTGTGATCAAATTATCTTCCACTAAGCCATTACAATATTC
TTATCTTAAAAAGCTGTTTGGCTGGCTTAACTTCTGCAAA
ATACTACTAGCAGGCCTGTAGCGGTTCAGAAGACCCACCC
CTCACTGACAAAAATCCAGAATTTGTACCGCTCATGCTCA
TTTGTCCTATTTTGACTGCCAACATTCAGTCATTAATTTA
TTTTTTTTTGGCTTAGTCCCTCTATTAATCTGGGATCGCC
ACAGCGGAATTAACCACCAACATTTCCAGCATATGTTTTA
CACAGCGGATGCCCTTCCAGCTCATATGTTTGTTTCACTG
AGAAACATCTACACACTCATTCACACACATACACTACAGA
CAATTTAGCCTACCCAATTCACCTATACCACATGTTTTTG
GACTTGTGGGTGAAACCAGAGCACCCGGAGGAAACACGAA
AACTCCACACAGACACGCCAACTAACCCAGCCGAGGCTCA
AACCAATGACCTTCTTTCTGTGAGGCGAACGTGCTACCCA
CTGCACCACCATGCAGCCCTGCTATGCCAACATAAATAGT
AAAAATAACCCATCGAAAAGGCTTTAAGATCAAGCGGAAT
CCTGGAGTGACTTTAGTTAATCAGTTTTGGTCGATGCAAA
CAATTATTTTTCAAGAGTCCAACATCCAGCTGTGCAAGAA
AACATCTGACACATAAGAGATATCATGTTTTGCTAATGTA
TTGTTTTTAAAAAGAGAAAACATTTGACAAGAAACTTTTA
GGCGAGGCAGTGGCGCAGTAGGTAGTGCTGTCGCCTCACA
GCAAGAAGGTCGCTGGTTCAAACCTTGGCTCAGTTGGCGT
TTCTGTGTGGAGTTTGCATGTTCTCCCTGCCTTCATGTGG
GTTTCCTTCGGGTGCTCCGGTTTCCCCCACAGTCCAAAGA
CATGCAGTGCAGGTGAATTGGGTAGACTAAATTGTCCGTA
TTGTATGAGTGTGTGTGTGGATGTTTCCCAGAGATGGGTT
GCAGCTGGAAGGGCATCCGCTGCGTAAAAACTTGCTGGAT
AAGTTGGTAGTTCATTCCGCTGTGGCGATCCCGGATTAAT
AAAGGGACTAAGCCAACAAGAAAATGAATGAATGAAGAAA
CTTTTTTCTAAATCTTGGACCTTATTCTTAACAGAAAACA
TGACAAAAAAAAGTGTGAAGCACCAAAAGTGACCCATATT
AAAATAAATTTGAATACTTATTTGGCAATTGTTGTTATCT
AAGAATTTTCAAATGTATTTTTTTTTTACAATAGTGTTTA
CAAAAATTGTGATGCTCTAAATTATTATTATTATTACGTT
TTAATTTTTTTATTATTCAAATTACAATAAACTACAGTTT
TTAATTTAAAACTGTTTTTTTATGAAATACGATGTAATAA
ATTTGTGTTCTAAAAATAAATATTTGCTATATTTCTTTAA
TCTAAATATTTAGTAAACATTTTTGGTGCATCAAAAAGTG
TGGTTATCACAACCATCCGACAAGCTACTTGAGCTAAAAA
AAAAATTGTGCTTAAAATGTCACCTAAATTCAGTATTAAA
ATCTCACAATTAAATAGAAAATGAGGTGAATAACTGCAAA
AAGGTCCACTTCTTGAGAAAAATAAACCACCTCTTTCACC
AGGTTGGCTATGGGCATGACTAGCCCAACATTGCCTGTCT
CCACATACTTTGGGCATGTACAAGTGGTTGGTACAACTTC
AGGACAATATAATGTTGTAATTATCCACAGTTCGAGTGAA
CTTGGTACAAATGAGTACATTAAAGATCTGGACATCAGCT
GCTGACAAAATCTCCATGTTTATTGCACAAAACAATGATC
AGGATCCAGAATGATTGCCTTATTTTGTATAATTGATACT
TGATACTGTACTTTGTATTTGTTTTTTGTTTCTGTTAACT
TTTATTCATTAAATACCCCAGTTTAAAGAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pon1-201 Contained in:
[BAC] DKEY-56F14 (1) (order this)

OTHER pon1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028551 (1)
  • Ensembl_Trans:ENSDART00000019353 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC080844 (1) 3810 bp
    CITATIONS (2)