ZFIN ID: ZDB-TSCRIPT-090929-10985
Transcript Name: trim35-29-201
Previous Names: trim35-29-001, zgc:103481-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028496 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028496|OTTDARG00000022188|ZDB-GENE-041114-35 trim35-29|OTTDARP00000023295 CH211-243D12.1-001 LG_ BX548254.7 Danio rerio protein_coding KNOWN, 1873 bp
ATTGTTGGAGCTGAAACCTGCAGGAGTGAAGCTCTCCATA
AGCATGGTTGGTTACTTCTGTGCTAGAGACTTACAACCGC
AAAACTCGACTAAGGACTAACAACAGAGAAAATAACTGTT
ACTTAAAAGAAGAAGAAGAAGAAGCAGCAACAACAACAAC
AACGTGAATCTAAATCACGACTTTAACGCTGAAGAATGGC
TTCAGTGAAAACAGTGTCTGTGGAACATTTCTCTTGTCCA
GTTTGCTGTAAAATCTACAAGGATCCTGTTGTGCTGTCAT
GTAGTCACAGTTTCTGTCAAGAGTGTCTTCAAAAGTTCTG
GATTACCTGCAACACTCTAGAGTGTCCTGTTTGCAGGAGA
AGATCGTCCAGAGATGATCCTCCTTGTAATCTTGTTTTGA
AGAACTTGTGTGAGTCACTGACAGCAGACAGAGCTTCAGG
ATCTGAGCTGGTCTGCAGTGTGCACAATGAGAAACTTAAA
CTCTTCTGTTTGGATGATGAACAGCCTGTGTGTCTTGTGT
GCAGAGATTCACAAAAACACACCAATCACAGGTTCAGACC
CATTGATGAAGTTGTTTTATCTTACAAGGAGGAGCTCAAA
AAAGGACTGAAGTCCTTTCAAGAGATGCTTAAACACACCA
AAAACCTTAAAGAAAAGTGTGATCAAACAATCCAGCACAT
CAAGAGTCAGCGTGAGAGCACGGAGCGGCAGATTAAAGAG
GAGTTTAGGAAGCTTCATCAGTTTCTGCACGATGAAGAAA
AAGCTTCAGTCTCTGCACTGAAGAAGGAGGAAAAGCAAAA
GAGTGAGATGACAAAGAAGAAGATTGAGGAGATGAACAGA
CAAATCTCAGCTCTAGCAGACGTTATAAAAGATATAAAAG
AAAAGATGAATGCCAGTGACATTGTATTTCTACACAGCTT
TAAAGGCATCAAGGAAAGAGCTCGGAGTTCACAGCAGGAT
CCACAGATGATTTCAGGAGCTTTGATTAATGTGGCAGATC
ATCTGAGAAACCTCACCCTCAGAGTCTGGAAGAAGATGCA
GCAACTTGTTTACAACACTCCTGTGACTCTGGACCCAAAC
ACTGCAAATTCATGTCTGATTCTGTCCGATGATCTGACAA
GTATGAAATGCAGGGCTTGTAGTCAACTGGTTCCTGACAA
TCCAGAGAGATTTGACCCATATGCTTGTGTTCTGGGTTCA
GAAGGCTTTAACTCCGGAACACACTGCTGGGATGTGGAGG
TCAAAGACAATTCGGACTGGATTATAGGAGTAACTACAGA
ATCAAACCAAAGGAAAAAAGAGTTTTTTAAAACCAACACC
TGGTGTGTGGTACAGAGATGAAAAATATTCCACACAGGCT
CTAGGGCATTACAACACTTTTTCAGTAAAAGGGAAACTTC
AGCGTCTGAGATTAGAGCTGGACTGGGAAAGAGGAAAACT
ATCATTCTGTGATCCTGTAACCAACACAAATTTACAAACA
CTCATAATCACCTTCACAGAGAGAGTCTTTCCGTTCTTCT
ATAGTTCTGATGTTCTTTCTCCTCTAAGGATTTTACCATC
TAAAGTTTTTGTGAGTTTTTGGGGAACATAAAAAGGCGGT
AACCTGTTAAAGAAGGAATAAATGCGTTTATAAAATTATG
TTTGGTTTACGTGCTAAAAAATGCAAATCTAGAATAAGTA
GACAATGTTTGAGCTGATCCTGTCATATTAAAAATGTTAA
CAATGAAAATGTATTTATTTTTTTCCCCCCTCTTGTTTCT
TACGTGCGGGAGATTAGGAGTTAAAATCAAATTATAGCTA
AATAGATTTTAAATGAAAAGATGTAATAAAGCATCAAAAT
TGTTCCAATAAGGGACTTAGAATTAAGTCAAAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
trim35-29-201 Contained in:
[BAC] CH211-243D12 (1)

Genome Resources: Vega_Trans:OTTDART00000028496 (1),  Ensembl_Trans:ENSDART00000078124 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC085530 (1) 1742 nt
GenBank:BI867339 (1) 565 nt
CITATIONS (2)