ZFIN ID: ZDB-TSCRIPT-090929-10984
Transcript Name: ino80c-201
Previous Names: ino80c-001, zgc:86850-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028495 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028495|OTTDARG00000022187|ZDB-GENE-040625-97 ino80c|OTTDARP00000023294 CH211-243D12.2-001 LG_ BX548254.7 Danio rerio protein_coding KNOWN, 1402 bp
ATCTCTTCCGGGTGAACGGGATGTTGTGGTTAGCAGTAGG
CTAACGTGCTCACAGATGAGTACCTGCAGAAATTTTGGAT
ATGTTCGTTAAAACTCAATGAGAACAAATGTCGGCCCCAT
CCGAATCCGGAGTATCAAAAGCAAGGGAATTAAACCCAGC
GACGCTATTGGCGAGTAAAGCGCAGACAGCGGCGGCATTA
GTTGCTCAGGCCCGGAGCAAGAAACGGTCCGTGAGCCCCG
CCACACACACAACACCACTGACCAATAACATTATCAACAA
CAACAAAAAGAAGAAGACACAACCCGCACTCTCAACTGCT
CAAGCTCAGGTTGCCCCAGTTGAAGGAACCTCTGAAGTAA
AACCAGTGGGATCTGTTGATGTAGAGACTGCTACCAAGAG
TTTGCCTTTTAAAAACCCTGACTTTGTGCACTCAGGTATT
GGTGGAGCAGCAGCAGGGAAGAAGAACCGGACGTGGAAAA
ACCTGAAACAGATTTTAGCAGCTGAGAAAGCGCTACCCTG
GAAAATCAATGATCCTAACTACTGCAACATAGATGCACCT
CCTTCTATGAAGCCAGCCAAAAAGTACTCTGACATCTCAG
GTCTACCGGCAAACTACACCGACCCTCAGACTAAACTGCG
ATTTGCGTCGACTGAAGAGTTTTCCTACATCCGTCAGTTA
CCCACAGATGTGGTGACTGGATACTTGACTCTGCGTAAAG
CGACCTGCATTGTACCCTGACAGAGACCCACACTTAACAA
AGAGTTAATGGGTTTTTTTCAAGCACAGACTTTGACTGGA
TTATTTGGAATGAAATGCTTTTACTCTTATTTTTTTCTAA
AACAGTATATCTGTCATGTTAATTGTGAACCAAATATAAT
ACATTGCCCATGCAGACTGTAGCTGACTTGCTAGTTGTTT
TCTTTTGCTGCCATCTACAAGCATCATGATGAATTACAGT
AGTCAACATTTGAAGTGCTTCAGAACCTTAAATCAAAGTT
GTCCTTGAACTACTGAATAGCACTCAATCTGGTCTTGAGA
CAATTTTCAGAAACATTTTTGATCCATGTTGACTTCTGTA
CATGCACTGAGAAAATAAACCTGCAAACCTTTTATTTTAA
CCATATTTAAAATTATACCCTAAATCCAGACAGTATTTCA
CAGTAGCAGATCTTAAATCAAATCAAATGTTACTGTTGGC
TATAACCAGGTAAACATGTCAATTTAGACAATGTATAGAA
ACAGGACTTACATCATTTAGACAATTTATTTTATCTACAC
TACCTATACAAGTTTATTGTTTTAGAAATGAGTGCTTTCT
ACTAATTAAGGTTGCATTTGCTTGATTAAAAATTCAATAA
AAAGGCAAATGTTATTTAAATTTAATAAATCTCCAACCTC
CA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ino80c-201 Contained in:
[BAC] CH211-243D12 (1)

Genome Resources: Vega_Trans:OTTDART00000028495 (1),  Ensembl_Trans:ENSDART00000078119 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC071494 (1) 1400 nt
GenBank:CO958819 (1) 816 nt
CITATIONS (2)