ZFIN ID: ZDB-TSCRIPT-090929-10966
Transcript Name: slc38a7-202
Previous Name: slc38a7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028475 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028475|OTTDARG00000022174|ZDB-GENE-040801-266 slc38a7|OTTDARP00000023277 CH211-122F10.2-001 LG_ BX957362.26 Danio rerio protein_coding KNOWN, 2889 bp
TAGAAACGCCGAACAAGAAGCAACAGCATCGCTGTCACAT
CTGCATCTCTGTTCTTCGCTCAAACGCAATCTTATGTAGA
CCTATGCTCTTCATCACGGTACGGAATCAGCCAAGCATGA
ACGCATGAGGTGGTTTACACCATCTGCTGCTTTACCACAC
CTCGCTTGTACCTGGAGAGTTTGTTAGCTAAACAAAACCG
CTGTTGTTATGCGAGTCACGTGACCTTATCGCATCTCTTG
CTGCTGAGGAGATTTGTTAATCCACGTGTCTGTTTACACC
TCTACCCCCTTGATGGTGGTGACTCTGACTGACAGCTCAA
GTGTTTACCTCAGTTTATGCCCTATGATGTTCTTGTGAGT
TTATCTGCGAGTGTATGAGAAGGCAAGCGTCATGTCGAGG
CCGGACAGAGCGATCAACAGTGAAGCAGGAGACTGGGGTT
ACAGTGAAGATGCTGGGGAAAGAGCTTGGCTGCTGCAGAG
CCCCAGTGTGGACTCCGTCCAGCCTCCCAGCCAATCAGAT
GACAGTAGGGGAGGGACTTCATCACTCGGGGCTGTTTTTA
TTGTGGTGAATGCTGCTCTGGGTGCTGGACTTCTCAATTT
CCCTGCTGCTTTTAACATGGCTGGAGGCGTCACAGCCGGA
GTGACACTTCAGATGTGCATGATGGCCTTTATTATCACTG
GGCTGGTGATTTTGGCTTATTGCTCTCAGGTGAGCAATGA
ATCAACCTATCAGGAGGTGGTCCGTGCTGTGTGTGGGAAG
GCTCTTGGTGTCATATGTGAGCTGGCGATTGCTGTTTACA
CCTTTGGCACCTGTATAGCCTTCCTCATCATTATTGGTGA
TCAGCTGGACAAGCTGATCGGCGCAATAAACAATGAGTCA
GAGAAGGAGATAAGTTTGCACTGGTACACCGATCGTAAGT
TCACCATCACTTTGACCTCAGTGCTGATCATTCTGCCTCT
GTCTATACCCAAAGAGATTGGCTTCCAGAAGTATGCCAGC
ACCCTGAGTGTTATCGGCACCTGGTATGTGACAATCATAG
TCATAGTCAAATACATCTGGCCCAGCAAAGATGTTTCTCC
AGGAATCATCCCTGTCAGACCTGCATCCTGGACAGATGTG
TTCAATGCTATGCCCACAATCTGCTTTGGGTTCCAGTGTC
ACGTCAGCAGCGTTCCTGTTTTCAACAGCATGAAGAAGCC
AGAAATCCGGCCGTGGTGGGGAGTTGTCACAATCAGCATG
ATCATCTGTCTCTTTGTGTATACAGGCACAGGTGTCTGTG
GCTTCCTATCATTCGGCTCAAGTGTAAGTCAGGATGTGTT
GATGTCATATCCATCTGATGATGTAGCAGTGGCCATTGCT
CGAGCCTTCATCATCATTTGTGTTGTTACCTCGTATCCAA
TTCTGCACTTCTGTGGGAGGGCAGTGCTGGAAGGTTTGTG
GCTGCGATTTAAAGGAGAGGAGGTGGAGACGGATGTGGCA
AAGGAACGGAGACGCAGGATACTGCAGACCCTCGTCTGGT
TTTGTCTAACGCTCATTCTGGCTCTCTTCATTCCTGATAT
CGGAAGAGTCATTTCACTCATTGGTGGTTTGGCTGCGTGC
TTCATTTTTGTCTTTCCAGGATTGTGCTTGATTCAGGCAA
AGCTTTCAGAACATGATGTCAGATCTAACAGCTGGAATGC
AATGGTGGCCTACGGGGTCATCATGGTTACGATTGGCGCT
TTCATCTTTGGCCAAACTACCACAAATGCCATCTACAAAG
ACATCATCAACAATCCCAACAGCCCGTAGGAGGGTTTGCT
GTGACTGCATGAATAGTAGAGCTTGAACAAACAGAGGCAA
AGTGAATATAGGGGAAAGAAGACAGTCAAAATCAGACCGC
TGACCTCTATTACATGTTCAGGAGGCTGTTTTAAATTCTT
CACATTGTAATGCGCAGCTGTTCCTCTGAAGTCTGTTCCT
CCTGATGTAGTGGATCATCCACCAGCATGCAGCATCATCT
CTCTGCTCTGGAACTATTGATCCTGTGAAGGAAATATTAA
TGACCTGACTGAATTGTGGACATTGTGTTAAATCCTACAA
TATTAGATCTTCCAAATATACTTTTTTTTTTGCAATTTGC
CTGTTTTCTTTTTATATATTTTTAATAAACTGATTTGTGA
TTTTTATGAGAACCTTATATACTTGATGTTGTAAACGTGG
TCAGTATTCATAATGTTTACCAATGAAATATTAATTTCTT
TATGGACTTGCACTGCCAAACATGTAATTCTACAGTGTTT
GTGTGTACATATAAGCCACTGTAGACCAGAAGTTAAATCT
GTACTTCAGGATATTTTTGAAGAATGGTTTTATTTTAGTT
TGATGCATGAATGTTGTTTCTGTTTAGCACATTTTCTAAA
CGAGCATTGTGTGAAATTTGTTTACACCCTGGGTGCACAG
TCTCTAGTTTTAAAAGTTCACTGACACGCAATGAACACTA
GACGATTGACTTGAAAACTTCAGGTTTAATTCAATTTCAT
TTATAAGGGAATGTAGGTACATGTACATTACTTGGGTGAA
AATGAGCATCTCTAGAATATTTCTTTGAACCATACTCCAA
ACAGCTTAGGTGTATGTCACGTTGGTGTGCGGTAGTGACC
TCATGTTTTTCTGTTCTTGAATGTTCGTTTAATAAGGGAC
TGTTCTCATATCCCATCTCATGGATTTAAAAATCAACACT
AGATGCATGTTTCCACAATCATGTATTATTGTATGTTTCA
GTGCAATCGAATGTTCCATATTATGTCAATTAAAATGTTT
TTGTGCTCATTGTGATCCTTTTTTGATCAACTGCAAGATC
AAGTTAAACTGTTAAGCATTCAATAAAAAATATTTAAGTG
CATAAAAAA

slc38a7 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA slc38a7-202 2898
slc38a7-203 (1) 2851
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc38a7-202 Contained in:
OTHER slc38a7-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028475 (1)
  • Ensembl_Trans:ENSDART00000073839 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC077100 (1) 2690bp
    GenBank:BC100117 (1) 2171bp
    GenBank:CT703375 (1) 838bp
    CITATIONS (2)