Transcript

crot-201

ID
ZDB-TSCRIPT-090929-10936
Name
crot-201
Previous Names
  • crot-001
  • zgc:110643-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028444 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028444|OTTDARG00000022155|ZDB-GENE-050522-35 crot|OTTDARP00000023250 CH211-215G1.2-001 LG_ BX322614.3 Danio rerio protein_coding KNOWN, 3323 bp
GACTTCACGTACAGTAAATGGGGCAAAGGTAAATGGAGCG
ATTCCCTTTCTGGAGTTGAATGCACACATCGAGTTTAGTC
AGTAAAGTATCCAAAAGACTCTCAATAGTTTTACCCGAGC
AGATTTACAGTCCTCTCAGTTTCTGGATTAACTACTGCAG
TCACTTTCTCAGCTGAATCAGTGCAGTAGTCATGGATAAT
CAGGTCTTTGAGTCAAGCGCAGAACGGACATTTCAGTACC
AGAGGAGTCTTCCCCCTTTACCCGTGCCCGCGCTGCGCGA
CACCCTCAGCAAATACTTGGATGCAGTGAAACCTTTTGCA
TCTGAGGAGGAGTTTGGAGCCACAGTGGCCATTGTTAAGC
GCTTTGAGGAGGGCATTGGACAAGAGCTGCACCAGAAGCT
TCTTCAGAGAGCCAAGAGCAAACGTAACTGGCTAGAGGAA
TGGTGGCTGGACACAGCGTATCTAGAGGTGCGCATCCCCT
CTCAGCTCAATGTGAATTTTGGGGGACCCACAGCTTACCT
GGAGCACTGCTGGCCTCCACAAGAAGGGACACAGCTTGAG
AGGACCAGTTTGGTTTTGTGGCTCACCTTCCAGTACTGGG
ATCTTATCCGCACGGAGAGGTTGGCTATTCATAAAGCAGG
AACGATACCCTTTGACATGGATCAGTTCCGCATGCTCTTC
TGCACCTGCAAAGTTCCTGGCATCACTAAAGACACCATCC
TCAACTTCTTTAAAACAGAGAGTGAAGGACCCTGCCCGTC
TCATGTGATAGTGATGTGCCGTGGAAGGATTTTCACATTC
GATGCCCTCTGTGATGGACGAATCCTCACTCCTCCAGAGC
TGCTGAGGCAGCTGACGTACATTAAAAACTGCTGTGATGG
AGAGCCGGAGGGGGATGGAGTGAGTGCGCTCACCACTGAG
GAAAGAACACGCTGGGCAAAGGCTCGGGAATATCTGATCT
CCATTGATCCTGTGAATAAGACCATACTGGAGACCATTCA
GAGTGCTTTATTTGTGGTCGGCCTGGATGATGCCAAACCT
TATGCCACACCAGACAACTACACACAGTTGACTGATCTGG
CGTTGACTGGTGACCCCACAAACCGCTGGGGAGACAAATC
TTACAACCTCGTTTGCTACTCAAATGGGATCTTCAGCTCC
AACTGTGATCATGCGCCATATGATGCCATGGTTTTGGTGT
CGAATGGATACTACGTAGATCAGAAACTGAAGGCCTGTGG
TGGAGTGTGGAAGGGTTCGGAGGTTGTGCGTGAGATGCCT
GTGCCGGAGGAGCTGATATTCACTGTAGATGAGCGAGTGA
GGAGAGACATCGCTCTGGCTAAAGAACAGTACAACAAAAG
TTGTCAGGACCTGCAGGTTGTCAGCTACGCCTTCACCTCG
TTTGGAAAGACTGCCATTAAGAAGAGAAAGCTTCACCCTG
ACACGTTTGTCCAGCTGGCTCTACAGTTAGCATACTACAG
ACAACACGGACAGCCGGGCTGTTGTTACGAAACAGCCACC
ACTCGCCGCTTCTTCCACGGCCGCACAGAAACCATGAGGC
CCTGCACCGTGGAGGCTCAGCACTGGTGCAGAACCATGAT
GAACCCTGCGGCTACTACTGAAGAGAAAAGACACACTTTA
CATGCAGCCGTCAACAAACACAACAAGTTGATGGCAGAGG
CTCAGGATGGGAAAGGCATTGACAGGCACCTGCTGGGTTT
GTATCTGATTGCTAAAGAGAACAGCATTCCTGTGCCGGAG
CTCTATGCGGATCCGCTCTATACTAAGAGTGGCGGAGGGG
GTAATTTTGTGCTTTCCACTAGTCTGGTGGGCTACACTAC
TGTTCTGGGAGCAGTTGCACCAATGGTCCGCCATGGATAT
GGATTTTTCTACCGCATTCGTGATGACAGAATTGTTGCAT
CCTGCACTGCTTGGAAGTCCAATCCTGAGACAGATGCTGA
AACCTTGTTTCAAAACCTCGCCACTTCATTACATGAAATG
ATGCACATCACGACCCAGTCCCAACTGTAAAGCAGAGCAT
TCTGGGAAAACAGTCAAAACCCAGTGGTTTAGTTCTGCTG
TTGGACAGACGTAAAGTCTCAGACACAGGCATCCCTGCAG
ACCAACATGACATCCTCACAGCTTCACTCATGTGCACAAT
TCAAATAGGAGATACTCAATAATTGTAGAGAAATACTGTA
GTTCACCAAAAATGTTGTGTTGACTTCTTCTCAAGAGGTT
CCTAACATTTTGTGTTAAGCACAAAAGGATATATTTTAAG
TAATGAGGAAAATTAGCAGCTGTCGAGTTTCATATTAGAA
AATATTATGGTTATCAATGGTTTCCGGTTTCCAGCATCCT
TCAATCTATTTTCTTTTGTGTTCGACAGAACAGAGAAACT
CAGTCAGTGTTGTCAATAATTACAGAGTTTTAAAGCTTAG
TGAACTATCCCTTTAAATGAACACAGACATTACAATTCTG
CCATTTCTAAAAAGGAAATCAATGGTTACCATTTTACATT
CTTCAGAATATCTTATTTTGTGTTCATCTAAAAAAACAAC
AAGTAAAGGGTAACAAATAACAGAATTTTCAATTCTGGGG
GAGCTGTCCCTTTAAGATGCTTTGCAGGTGCTTTGAAACG
GTCATGTGCCTTCAGTTCATCGTCTCTTAATCACTTCAGT
CAGGAAATCCACTGTGACTTCTAACCTCCATTTTCTACTA
CATTAACAGTATTGTTTTCTGTGATAGTGTCCACTACCAC
AGGATTCTCAGGCCTAGTGAGTCCACTAGAAACATTAACA
CAAAACAGACTGATCATAAGATGACCTTTAGTGACTGATG
GGTGGTAAATCAGCTCTGATGTGTGTAAACTGTACTGATT
TCACAGTTTTAATGCAGAGATCAATGCAACATATAATTAG
TTTATTTTCTTAATTAGAAGATGTAAAGGCTTTACACGTT
CGAGCCTACTGTGTGTGTTTTGCATCAATATGATGTAAAT
GAATGGTTTTATGTTGTGTGGATGTACATGATTAAATCAT
GTGTTTGATAGGTGTACATGTAATTTGCACTGCTTTCCTT
GTTCATGGGAAATTTTTATGCTTCATTGTTAGAGTTTTTT
TGCAATCATTCCACTTTTATTAGCAAATGTTGTTAAGCAC
GCATGTAAATTTGAATGTGAATTGCTCAGAGGTTTACAGA
GAACACAGGTGGGCTGGAGACCGGCGTCTCTTGAATATGC
ATTGATTGTAAACATTTTACAGTAGCAAACTGAAGTGATT
TCAGATCTCAAATCTAATAAAGTCATTTTGTGGAAAGCAC
AAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations