Transcript

arfip2b-202

ID
ZDB-TSCRIPT-090929-10926
Name
arfip2b-202
Previous Names
  • arfip2b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028433 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028433|OTTDARG00000022144|ZDB-GENE-050417-131 arfip2b|OTTDARP00000023239 DKEY-22L17.1-002 LG_ BX530069.10 Danio rerio protein_coding KNOWN, 639 bp
ATACAAACAAGCCGCCGGACATAGTGGAATCGGTTGAACA
TGCGAATAAACGCTTGCTTGTGATTTAACATAAACTCAGC
CTTCATGAATGCACGCTGTTATTGTCTCTGCACTCTTTCG
GAAGTGTCAGGGTTTGATTGCGCGTGAACCAGGATAAATA
TCCAGCACGCGTGACAAATAGCTCATCCTAGAGAAGGAAA
CGCACAGTAACACTCAAGTATGGCGGACAGTATGATGAGT
AAAGCCGCCACAATGGAGATTCCTATTAGCAGTAATGGGG
ACTCTCGAAATCTGGCAGAAGATGACAGTTTGGAGCAGGC
TGCAAAGATTCAGTGGAGCTTAAGAGAGAAGGACTTGCAG
CAGGTAATGGTGTCTGGGCCCAACTTAAATGAGACCAGCA
TCGTATCAGGTGGTTACGGCGGTACAACAGAAGGCATCAT
TCCAACCAGCTCCATCAAAGGCCCTGCAGTCCGTATTAAT
ACTGATTTTCTGGGCAACAGACGCATTCCAAATGAAGGGC
AAGGGTCCAATATGGATTATGTCGGTAGCAATTCCTCAAT
GGCAGCAGAAGAAGCCACAAGAGGCGTTGCTGTGGAGAAA
TTTGACATAATGAAGAAATGGGGTCTGAACACATACAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations