Transcript

kcnip1b-202

ID
ZDB-TSCRIPT-090929-10892
Name
kcnip1b-202
Previous Names
  • kcnip1b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028397 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028397|OTTDARG00000022122|ZDB-GENE-041212-57 kcnip1b|OTTDARP00000023214 DKEY-4C2.4-002 LG_ BX005027.13 Danio rerio protein_coding KNOWN, 1900 bp
CCTTCAGAGTCCACATGATAGACAGACAGAACAGGGAGAA
AGTCAGAAAGAGGGATAGCATTAAGTAACAACTGGGAGTA
TCGAAGTGGGTTGAAGATCAGGAGACAAAATACAAAAACA
AGGAATATCCAAACTGTATTGAAGATGGGCGTAGTGTTGG
GCACTTTCTCTATGCACACCAAACAGGTCTCCTACAGGAC
AGATAAAGTAGATGATGAATTAGAGATGACAATGGTCTGC
CATCGACCGGAGGGTCTCGAACAGCTCGAGGCGCAGACAA
ACTTCTCCAAGCAAGAGCTACAAGTTCTATACAGAGGTTT
CAAAAATGAGTGTCCAAGTGGAGTGGTGAATGAGGACACT
TTTAAACACATTTATGCACAATTTTTTCCACATGGAGATG
CCAGCACATATGCACATTATCTCTTCCATGCGTTCGACAC
CAGAAATAATGGATCAATAAAATTTGAGGACTTTGTGATG
GGACTATCCACTCTATTGCGGGGGACAGTCAGAGATAAGC
TGGAATGGACATTTCATCTCTATGACATCAACAAAGATGG
ATTCATCAATAAGGAGGAAATGACAGAGATAGTGAGAGCG
ATCTACGACATGATGGGGAAATACACATATCCAGCTTTAA
AAGGAGACGTACCAAAGGCGCATGTGGATGCTTTCTTTGA
GAAAATGGACAAAAACAAAGATGGAGTTGTAACATTGGAG
GAGTTTGTCCTTGCCTGCCAAGAGGATGAAAATATGATGA
GATCCATGCAGCTCTTCGAAAACGTGATGTAGAGAGGATC
GACGAGAAGAAGAAAAGAACAAAACAGAGAAGAGGAAAGG
AAGGGAAAGAAAGCAAGAGAGATTTTATGTTTAAATACAT
ATCTGCTATATTTCACAAGGGAAATTGAAAGCCTGAGAAG
GATGAGAGTCTATGAGCTTTGTTTTTCTCTCTCTCTATTT
ATATCTTGTAACTTACTAAATGTTGTCTCTTGCTGGTGTT
TTGGGTAATTACCGGCCCAGAATCCACCTTTATCCAGCCA
CTGAAGACTACATGAGGTTTCATGACTGTTTGGAAGGCAA
TGTGCAATGACTAACTAACTATTGGGTGGCAATGATCAAC
ACCCTTGCTCCCTGTGACCATTTTCTTGACCCTAGAGCTC
AGGACTCTGCATTTAGTGTTCTGGAACTGCATCCAGGAGG
AAACACATCCTCCATTTGCTTGCTTTCTCGACAAAAGAGC
TTGCATGATGATAAAGACCAGCTGATATGAGTTGCTTGAA
AATAACGTTGGCCTTCTAAATATCTGTTTTTATGATTTGC
TGTATTTATCTATGAAACAGGGTTTGGAGGATAATATTTG
GATGTTGATTTTGTGTCTTGTGTTGTCAACGTTGTTTGTT
TGTAATTGGTGTTTCCAGACGACCTGCTTATGTCTGTCCG
TCTCAGTACTTGCCAAGCCATTTTGCCCATTGGACCATAG
TGAAAAATGTGGGACAGAACTTACTGTAAAAGTGTGTCTA
TGTATGGCAAGGTGTGAGGAGAATTAAAGAATCTGTATTT
AAAATCTGTATTCAAACCCAACAAATGACAATCTAGCTTC
TGGATATTCTTCTATCCCTTGATACATTTGCATATGTTCA
AAAAAGACAGTTATTTGTAAGTGGAAAAACACATCCATTT
ACAGTAAATTGCATAAAAGGAAAACAAATACATTAAAGGG
AAGTGGTCAGGTTTAATTAAATGACATATAAGCTATGTAT
ATATACAGTAATTGCATAAGTATGGTGCCATATGAAGAAA
TGCCCAGTGAGGCAAATACAAACTGTGAAAATGAAATAAC
AGAAATATGCTGTGCAATTGCAATATCAGTCCAAACTGAT
TAAAATCATTTGTGGAAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations