ZFIN ID: ZDB-TSCRIPT-090929-10851
Transcript Name: morn5-201
Previous Name: morn5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028354 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028354|OTTDARG00000022094|ZDB-GENE-050522-267 morn5|OTTDARP00000023181 DKEY-47M8.5-001 LG_ BX571668.20 Danio rerio protein_coding KNOWN, 1589 bp
ATCACGCTGTTGCTTTGCTGTAGGTCAACATGGAGCTCAT
GGGTAGCAGTTATGACGGAGATTATAATAATGGAAGGATG
GAGGGGACAGGCGAATACACAATCCCCACTCACACCAGAT
ATGTTGGAGAAATGAAAGATGGCATGTTCCATGGAAAAGG
AGTGTTGCATTTCCCCAATGGAAGCAAATATGAAGGGACT
TGGGAGAAAGGAATATGCAAAGAGGGAAAGTATACATTTT
CTGATGGCCTGAAGTATAAAGAGACTGACTGGGATTACTG
TGATGGCAAAGACAGGCGTTTCTACTCTGAGAGATGTAAT
GGCCTCAAACCAGCAGGGGAATCCCAGTTAACCGATCCAG
ACCCCCCGCGTGTTATTCCTGATGGATGCTATGACACTGG
TGATGGCTTTTATGATCCCAATACAAGAGTCGTCAAAGGC
TATGATGGCAATTTTCTCAGGAATGCAGATGACCAAGAAC
ACGAGTGGATTGTGCTGAGCTGCAGGAAGAGCTTGGATGA
GTTCACTGGCTATTGTCCAAGAGCAAGCACACTAGAAGAG
AAGTGAGAATACTCACACACAGACAGCCCATTGTATATGG
ATGACATCTGAATGACACATTAATGCAGCTTTGAGATGCT
GTTTTTTTCAGTACAGTTGAATAAATCAAAGCAGGTTTGT
AATGGAAAACGTAAAATAAAATGTGAGGTTGCTAAAAGTG
ATATAAGCATATCTATAAACAACAGTTTATAGAGATAGTT
CATCCAAAAAATAAACATTTACTCACCCTCAAGTTGTTCC
AAACTTTTATTCAAATATTTATTTTTTTTTTTATATTTGG
CTGAACACGCACAAATACAATTTGAAGATTGTTGACTTCT
GTAATAGGGAAATAAATACTATTTATGTCAATAGGGATAA
ACAACAGCTTGGTTATACAAGTTTCTACAAATATCTTTTT
TGTGTTCAACAGAAGAATAAAACTTTTACTGGCTTGGAAC
AATTGTTAATTTTTGGATGAAATATCCCTTCAACAAATTA
ATAGTTTCATTATTATATACATTATATACTGAAAAAAATA
TGTCTGCAAAACTGTTGCAAACAATTTATTTGTGTTGAAT
TTAAACAAACGAACCAAATTTAATAAAATTCAACTTAATT
TGTTTGCTTAAATTCAGCCCAAATAAATTGTTTACAGCCA
CTTAATGTTAAAAAAATTTGTATATCCAAGGAATCATCTC
TGAACAATTTTTTTCAGTGCACTTAAAAAAATGTATTGCT
TGTTCAAACTACTTATTACAAATAAGCTGAAACAACACAA
CTCTTCATATTTCATTAGGACAACTTATTTTTTTATGTTG
TTTTTTATGTTCAATCCACATAAATTTGTTAAGTGTTAAC
TTAATCAGTTTGTGTTGGGACAACATGAGTGAATTGTGTG
GAAACCTGCATTTTTACAGTATATTCCAATGTTACATGTT
CAATGTATGTCCTTTGTGTTTTTAATTATTAAGCTCAAAA
AAAATGTTTGGTTGTGTAAGCCATAATGTTGGTATTCTAA
TATATTAACCAACCCATTTGGGTTACAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
morn5-201 Contained in:
[BAC] DKEY-47M8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000028354 (1),  Ensembl_Trans:ENSDART00000041382 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC095656 (1) 1605 nt
GenBank:CO924788 (1) 852 nt
GenBank:DV596199 (1) 803 nt
CITATIONS (2)