Transcript

ugcg-201

ID
ZDB-TSCRIPT-090929-10839
Name
ugcg-201
Previous Names
  • ugcg-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028341 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028341|OTTDARG00000022087|ZDB-GENE-030131-9885 ugcg|OTTDARP00000023173 ugcg-001 LG_none CT027818.17,CR931761.6 Danio rerio protein_coding KNOWN, 3003 bp
CCTCTCTCAGTCATCTGAATGTGTGTGTGTGTGTGTGTAC
TAGAGAGAGAGAGAGAGAAAGAGAGAGAGAGATTAGCTCT
TCTTCCTCCAGCATTAGGGCCGAACAGTGAGGTGTCAGCG
AGCGCATCCGGACACAGGACAGCAGAAGCAGCTATGGCCC
TGCTCGATCTCGCCCTGCAAGGCTTCGCCATCTTCGGCTT
CCTCTTATTCCTCGTCCTCTGGCTCATGCACCTCGTGTCC
ATCATCTACGTCCGTCTGCATCTCAACAAGAAGACCCCAG
ACAAGGTGCCATACAGCAAACTAGCTGGTGTTTCGCTGCT
GAAGCCACTCAAGGGTGTGGACCCCAATCTAATAAACAAT
CTCGAGACATTTTTTGAACTGGACTATCCCAAGTATGAAA
TCCTGCTCTGTGTTCAAGACCACGACGATCCAGCCATCGA
TGTATGTAAAAAGCTGCTGGGCAAATATCCCAATGTCGAT
GCCAGGTTATTTATAGGTGGTAAGAAAGTTGGCATCAACC
CAAAAATAAATAACCTCATGCCAGCTTATGAAGGGGCAAG
GTACGAGCTCGTCTGGATCTGTGACAGTGGCATTCGAGTG
AAGCCAGACACTCTTACTGATATGGCTAATCAGATGACGG
AGAAGGTGGGACTGGTTCATGGTCTTCCATACGTGGCAGA
CAGACAAGGATTTGCCGCTACATTGGAGCAGGTTTATTTT
GGAACGTCACATCCTCGTTCCTACATCTCCGCCAATGTAA
CAGGAATCAAGTGCGTCACGGGGATGTCGTGTCTCATGAG
GAAGGACATCCTGGACCAAGCCGGCGGCCTGATTGCTTTT
GCTCAGTACATCGCTGAAGATTACTTCATGGCCAAGGCCA
TCGCAGACAGAGGATGGAAATTTTCCATGGCGACACAGGT
AGCCATGCAGAATTCAGGCTCATACTCCATCGCACAATTC
CAGTCTCGCATGATCAGATGGGCCAAGCTGAGAATCAACA
TGCTGCCAGGCACCATCATCGAGCCCATCTCGGAGTGCTT
TGTGGCGAGTCTTATCATCGGCTGGGCCGCTCATCATGTG
TTCCGCTGGGACATCATGGTGTTTTTCCTGTGCCACTGCC
TCGCCTGGTTCATTTCAGATTATATCCAGCTCAGAGGAGT
ACAGGGCGGCCCTCCATCCTTCTCCAAGCTGGACTACGCA
GTGGCCTGGTTCATCAGGGAGTCCATGACTATTCAGATTT
TCCTGTCTGCTCTTTGGGATCCCACCATTAGCTGGAGGGC
CGGACGTTACCGCTTGCGTTGCGGAGGTACAGCAGAGGAA
ATCCTGGATGTTTAAACGGCACCGTGTGCCAAGGACTATG
CACTGCAAGACCACAAGGTCGCAGATGGACAAATGAACTG
CAAACATTTATTGTTTGTTTTGGGTTTTATTCCAACTTAT
AGTTTTTAACCTGTGACTTTAGCTCAATAGATTATTTATG
TCCTTGGTGCTTTTTTTTCTATTTGTTTTCCTGTGAGGTC
TCTTGATGATTTGAGACCTTGTTCTAGATGAGCCAAAATT
AATGAAGGGGCAAAGAAGAGAGAACTTTTGAGGATGAGGC
GGCACTTCAGTGGTCATCAAAACCCTGATGAAAAATATCA
ACTTTTTTCTTTTCTTTTTTTCTTTTTTTTTTATAGGTCC
TTGTAACATGTGTAGTGGTGATTGAATATGTGTCCAACAC
ATCCATTTTATCATACGTTTGGATGAATGGTACAGTTTTT
AAATGATATAGTGGGGTGTAGAAGTCACTTGCGTATGAAT
GGATCACATGCCTATCACAGTGTTGCTCTGAACATACAGC
ACTCTTGCCATATTTTATACATTTTTGGACCTCTGAATGC
TCAAAAACGGATCCCCTCAGGTCCATTTTATGTTTACCGG
ACAGCAATATCTTCTGAGGTGATGCATAGGGAATTTTGGC
AGAGCTTTGTATATGGATACTGTGGATCTATCCAGAAAAC
GACGCAACACTTGTATATGCTTGCACAGTTTTTGCAGCCA
CCCTGCAGTATTCAAGGCCTAGGTTAAACCTCGTTGTGAT
ACCTGCAGATTTAATCTCATATCTTATGAAATGTAGTGCC
ATTTGAGGAGTGAACGTTTTTATTGTTATAGTTTTGCTTT
TCTCCAAGGCCTTCGTCATCTCCCCTGCTTCATTCATTCA
TTCATTCATTCTCTGCACTGGTTGCTTTTGTACCAGGTTC
AGGGTCTGCTTAAACATTTCCTCCATGCTGCTGCTTGTTT
AAGAAGCTCTGTCAGTATTTTCCTGCAAAAGTTTGACTGG
ATATATATAAATGCTTACCTCCAAATTGTCCAAACATTTC
ATCCGACACCATTTCAGAACCAATTTCTGCTTGTCATGAA
GAGTTTGTGAAGTTTTCTTTATATACACTCAGTTTTTTTG
AGTTAAAGCACAAAATGATTTTAGAAAGTGCTATGTTTAC
GCTCTGAAACATTTCAGACCTCACAGTCACACCATGTGCT
TTTTGGCTTCTCAATTTCCCCATTTACATAATCCAACTTT
GCCATCAGTCAAACAGTATTCACGAAACAATTGACATTCT
TCTCTGTATTCCTTTTTTTTGTTGTTGATGTTCGAGGAAC
TGCTAGTTTCTGTTTTCTACTGCCAGCACTTGTCGTTAAA
CCGCTTCTTCTGCATTTTCCTCATTTTTTTGAGTCTCTCT
TGCCCGCCTTCTTGAGCTGATCATTAAGTACCCGTGTCAG
CACTGGCAGTATTGTTTTTACACAATTCACTTGGGTAGTT
CAACTCTTATTCAAAAACAAACACAAGTGAAGTACAGTAC
GTATGTCTTTATAGTCCCAACAGCTGCCATTTATGAAGTA
CACTGTTTTAACCCAATGCCAAACCCTCCATTGTTAATGT
TTTTTTGGTGTTGATTTCTTCTAATTTGAACACATCTGAC
TTTTGGGCTCACTATTGGAAATAAACTTGTGTTTTGTGCA
TGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations