Transcript

inip-201

ID
ZDB-TSCRIPT-090929-10838
Name
inip-201
Previous Names
  • inip-001
  • zgc:56259-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028340 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028340|OTTDARG00000022086|ZDB-GENE-040426-961 inip|OTTDARP00000023172 CH211-126I22.3-001 LG_ BX510369.6 Danio rerio protein_coding KNOWN, 618 bp
ATGCCTGACCGAAGAAGACAAAAGGAGAGCTACTTTATTC
TTCACAGCAGACCATGCATTTGTTTTAGGCTAAATTTTTG
GATAAATTGGGTTTGACGCCTACTTAGAGGTAGTTTCTGC
GGGTACATTTTAAGATTTATTACACATGTAAAAATGGCAG
CAAATCCGCCTGGACAAGGATTTCAGAACAAAAACAGAGT
TGCTATTTTAGCTGAGCTGGATAAAGAGAAAAGACGCCTG
ATCCAGAGTCAAACTCTCAACAACCCAGGAGCCAGCATTC
CCCTCTCCAGACCAGCTGTGAATAAAGAGTTCAGGGATCA
GGCTGAACAGCAGCACATTGCAGCGCAGCAGAAAGCGGCT
TTACAGCACGCTCATGCACACTCATCCGGCTTCTTCATCA
CTCAGGATTCCTCCTTTGGGAACCTCATCCTGCCGGTGTT
ACCCAGACTTGACCCCCTTGAGTAAATGAACATCAGCTCT
AAGGACAGTATTAGCATTTAGTGAAAACTTAGTTCCCCTA
TTGATGGATGACTCTCATATTTCATGAATTGTTTGGTCAA
TTTTTTTAAGACTGTTGTATTGTTGTAGTTTTTTTTACAT
AAAATTATGAAAACTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations