Transcript

slc12a2-201

ID
ZDB-TSCRIPT-090929-10833
Name
slc12a2-201
Previous Names
  • slc12a2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028335 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028335|OTTDARG00000022081|ZDB-GENE-040625-53 slc12a2|OTTDARP00000023167 DKEY-258N11.1-001 LG_none CR628409.9,CU459120.4,CU633864.7 Danio rerio protein_coding KNOWN, 1137 bp
CGCAGCATCACGGCGCAATTTAGCCAAGGAAAGCTCGATT
CATAGAGACTATCTGGGTCTGTAGAGTCCTTGCGAGAGCA
CACACCGGGCTGTGCGTTGGATGTTTCACTGAGCGTGTGT
AACTTGTCAGGAGTTGTTGACTGGACGTGCTGCTGTTCTC
CATTTGCATCCGCATGTGCGCGTCGCGCTGCGGGTTCAGA
GGGAAGCGCGGCGCGTTGTTTTAGTCTTCCTGCAGCATCA
GTGACTACGCTGGGTCACATCCATTGGCTCGTTTGCACTT
TTATCGGACAGTATCAGCTTTGGGAAGGGTTTTTTGACTC
ACCATGTCGGCGTCACCTCCAATCTCCGCGGGCGATTATC
TCTCTGCGCCCGAACCTGATGCGCTTAAACCCGCCGGTCC
GACTCCGAGCCAGAGCCGCTTCCAGGTGGATCTGGTGACA
GAGTCCGCAGGGGACGGTGAAACCACTGTCGGCTTCGACT
CATCCCCACCCGAGTACGTTGCCGAGCCGCCGCCCGATGG
GCTCCGGGATTCAGTATCTGGCGGCGAGGAAGCCAAGGGC
CGGTTTCGGGTTGTGAACTTTGCGGCCTCAAGTCCGGACG
CCGCGCCGGCGGAAACCGCGCAGAACGGGGACACGGTGAT
GAGCGAGGGCAGTTTGCACTCCTCCACCGGCGGCCAGCAG
CACCATCACTACGATACACACACCAACACCTACTACCTCC
GTACGTTCGGACACAACACCATCGACGCCGTGCCCAAGAT
CGACTTCTACCGGCAGACCGCCGCTCCGCTGGGCGAGAAA
CTCATTAGACCCACCCTCTCAGAACTGCACGACGAGCTGG
ACAAGGAGCCATTTGAGGATGGGTTTGCTAACGGCGAGGA
GTTGACCCCTGCCGAGGAGTCTGCAGCTAAAGATGTATCA
GAGTCTAAAGGAGTGGTGAAGTTCGGATGGATCAAGGGCG
TGCTGGTGCGCTGCATGTTAAACATATGGGGTGTGATGCT
CTTCATTCGAATGACATGGATCGTGGGCCAGGCTGGAATT
GCATATTCCTGTATCATTGTTATTATGGCAACTGTTGTGA
CAACCATCACAGGCTGCTCGACTTCTGCGATTGCAACTAA
TGGCTTTGTACGAGGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations