ZFIN ID: ZDB-TSCRIPT-090929-10828
Transcript Name: c6ast4-202
Previous Name: c6ast4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028330 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028330|OTTDARG00000022077|ZDB-GENE-050626-100 c6ast4|OTTDARP00000023163 DKEY-150L7.5-001 LG_ BX957297.10 Danio rerio protein_coding KNOWN, 946 bp
ATTGGCTTTAGAAATCTACGACAGAACTGGTCTTTGGACA
CCATGGTTGCAATGAAGGTGACTTTCGGCCTGTTGGCCCT
GATGCTGGTCTCCTCTGTTAGAGCTGAGGAGATGATGCAG
CCTGCTGCTGTGGATGAGTCTGCTGAGCTGTCTGTGTCTG
AACTGCTGCATAGAGCCAACAGAGGCATCATTCCTGAAGC
TGATGAGCCCAAGCTTCTGGATGACATTGCTGTGAATGAG
AGAAACGCTGATCCCTGCACCTCTTACAGCTGTCTCTGGC
CCAAATACAGTGACGGCAAGATTTATGTGCCTTACGTCAT
CGCCAACCACTACTCCTCCCGTGAGCTGGAGATCATCCAG
CGCGGTCTGGACTCTTTTGCTTCTGTCTCTTGTATCCGCT
TCTTCCGCCGCAGCAATGAAAGAGACTACATCAGCATTGA
GTCTCGCAGCGGGTGCTACTCTTACGTTGGCCGTCAGGGT
AATGTCCAGACAGTATCTCTGGCCCGAAGTGGCTGTCTTT
ACCACAGCACTGTTCAGCATGAGCTGCTCCACGCCCTGGG
CTTCAACCATGAACAAACCCGCAGTGACCGTGACAATCAC
ATCCAGGTCATCTGGGAGAACATCCTTGATGACATGAAGT
ACAACTTCAATAAAATCAACACCCTGAACCAGGGAACTCC
TTATGACTACAAGTCTGTGATGCAGTACGAGAGGTATGCT
TTCTCCAAGAACGGATATCCCACTATGATTCCCATTCCCA
ACAATAACGCTGAGCTGGGCAAGTCCACTCAGATGAGCCA
GAATGACATCACCAGGCTTAACAGACTCTACCAGTGCTGA
GCAGCACAAATTTAAAAGGATCCAAAGTCTCACTGATGTT
GCTGAACAACCATCAGTCTATCAGATGGATTAAGCACAAA
ACATCAATAAATTCTTTAAACCAGAA

c6ast4 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript c6ast4-204 (1)    Ensembl 805
mRNA c6ast4-202 949
ncRNA c6ast4-002 (1)    Ensembl 832
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
c6ast4-202 Contained in:
[BAC] DKEY-150L7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000028330 (1),  Ensembl_Trans:ENSDART00000144341 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC097232 (1) 958 nt
GenBank:CN323100 (1) 866 nt
CITATIONS (2)