Transcript

mns1-201

ID
ZDB-TSCRIPT-090929-10809
Name
mns1-201
Previous Names
  • mns1-001
  • zgc:65845-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028310 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028310|OTTDARG00000022067|ZDB-GENE-030521-42 mns1|OTTDARP00000023150 CH211-194P6.1-001 LG_ BX571811.5 Danio rerio protein_coding KNOWN, 1909 bp
GACAACGAGTCACAAACAACTGAGCGCCGTGTATTACACT
TTGTCTGGTTAGAAACCCTTATACCGCACGGAGCTGAACA
AAAACTTCCAGCACACCTTTAGGAATGTCTTTTACAAGTC
AACGGCGCAACATCTCTCACAACCACCATCAGAAGATGAT
CCTGGAGCACCGCAAACAGGAGGAAAGGCGTGAAGATCAC
TCCAAACGCGTCGTTAAAGAGCGGCAGCTTGAAGCCAACC
TTAGCTGCGAAGACAGAATCGAGAGAAAGCGTCTCCTACG
CAAGCTGCAAGATGAAGAGTATGGCAAACAAATCGAGGAA
TCACTTCTCAGGGCAGAAGAGGACAAATTATTCAGAGAGA
GGCAGCTTGAACAGGAGGAGAGGATGGCCAAGGAGCTGGC
AAGAATTAATAACGAGAAACTTCGAGATGAGAAGATGAGG
CAGTATATTAAAGAGAACAGTGTTGAGCTCCGAGAGCTGG
AGTTAAAGCTCAAGTCTGCTTACCTGAACAGAGAGCGGGC
AGCACAGATGGCAGAAAAAGAAGCGATGCGATATGAGACA
TTGAGAGAAGAGGCTATGATTGCACGTACAATGCGGGATG
AGCATGAGCTTGCAGAGATGGAGAAGGAGAAGCTGGAGCA
GAAGAAGTATGAAGAGGTGGTGCGATACCAGCAAGAACTT
GAGCGGCAGCTTGAGGAGAAGGAGCGCAAGAGGCAGGAAG
CCTATGAGGAGTTTCTTAAAGAGAAACACATGGTGGATGA
AATCGTGCGGAAGATCTACATGGAGGATCAGATGGAACTT
CAGTTACAACTTGATAAGATGAAGGCCACTCAGAGGTACA
TTGAAGATTTTAAAAAGCAACAAGCAGAGTGGAGACGTAT
GGAGAGAGAGAAGGTGGAAGCAGAGAACAGACGCATCATT
GAGTTTGCCCAGTACCAACAGAGGAAGGAGGAGGACAGAA
TGGCCAAAGTCAGAGAACGAGAGCAGGCAAAGGAGACCCT
GCACAAAATGCTTTCTGAGCAGATTGAGTTGGAAAAACAA
CAGCGAGAGAAGATGGAGCGCGCACGTGAGGAACTTTGCT
TGGAAGAGCAGGCAGAAGCTGCAAGGCAACAAGAAATTGA
AGAGATGGAGAAGAGGATCCGGCAGCGTCTGGAGCTACAG
CAAACACAGCAAGAAATGATGGCCTTCAAGAAGTTGCGCT
TACAAGAGGAAAAAGAGGAAGAGGAGGCCTTCAGACAAAC
GATGATGGCTAAATTTGCAGAAGATGATCGCATTGAGCAG
ATGAACGCTCAAAAGCGTCGTATGAAACAGCTAGAACACA
AACGGGCTGTGGAGCAGCTTCTGGAAGAGAGGAGACAACA
GTATCTGGCCGAACAAGAGAGGGAGGAACAGGAGAGAGCA
GTTGAACTGGAGAGAGAAGCTCAGCGCAGAAGGATCATTG
AAGAGGAGAGACAGAGGCTCCTGAAACAGCATGCGACTAA
ACTGCTGGGATACCTACCAAAGGGTATTTTCAAAGAAGAA
GATCTGGAGCACTTTGATGAGGATTTTAAAAACAATTTCA
AGCAAAGGCAGGCAGATATATTCTCAGATGAGGGCTGGGG
AGATGATTCACAGTAGGGTAATTCCACCATGATGGTAATT
TATGAACACTACATGGCATTCTTTTTCATTCTAAGCTGTA
TCTACTGGACTAGTATAGCTTGCTGCTGGGTGCATCTTCC
ATTTTCACAAAAGATTAGAACAAACGTCAGACATTATGCA
AAAATGTTTCCTTTAATAAAATGTCCATAGTATGTTCAAG
TTAATTGTAATTGTGTAAATGTCAAACTTATTTAAGCTAG
TGATTGTGGTTGATGATGAAATATTGGTCTCAAAAAGATA
CTACCTATTAAAGATGAACATTTGAATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations