Transcript

pip5k1ba-201

ID
ZDB-TSCRIPT-090929-10805
Name
pip5k1ba-201
Previous Names
  • pip5k1b-001
  • pip5k1ba-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028305 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028305|OTTDARG00000022064|ZDB-GENE-041010-81 pip5k1ba|OTTDARP00000023145 DKEY-3H23.1-001 LG_ BX640481.14 Danio rerio protein_coding KNOWN, 2414 bp
GCGTGCGCGTGGGCGGAGAGAGTTTGACAGTCAAACTGAA
GCTCGACACGCTCTCAAATGTCACTGAGAAACAAACCATG
ACTTAAAGAAACACGCTTTAGGCTTGACATTTTCTCAGGA
AAGCACTGAAGATGAGTGCAACGGCAGATGAGCCCGGAGG
TGAAAGACCTCAAAAAACTGTGGGAAAAGACCACAAAAAG
CTTTCATCTGAAGCCCTAAGAGGAGCCATTCAGCTCGGCA
TCGGCTACACCGTCGGCAATCTGACCTCCAAACCAGACAG
AGATGTGCTCATGCAGGACTTCTACGTGGTTGAGAGTGTT
TTTCTACCAAGTGAAGGAAGTAATCTCACCCCGGCTCACC
ATTATCCTGACTTTCGCTTCAAAAATTATGCGCCTTTGGC
TTTTCGATATTTTAGGGAGCTCTTTGGGATTAAACCAGAC
GATTATCTGTACTCCATTTGTAAAGAGCCTCTGATCGAGC
TGTCGAACCCTGGAGCGAGCAGCTCATGGTTTTATTTAAC
CAGTGACGATGAGTTCATCATAAAGACGGTGCAGCACAAA
GAAGCTGAATTTCTGCAGAAGCTGCTTCCAGGATACTACA
TGAATCTGAATCAGAACCCCAGGACGCTCTTACCGAAGTT
TTACGGGCTTTACTGCATTCAGTGTGGTGGAATGACCATC
CGACTGGTGGTGATGAACAATGTTCTGCCTCGATCTTTAA
AAATGGACTACAAATATGACCTGAAGGGCTCCACTTACAA
ACGCAGGGCCTCACGCAAGGAGCGCGCCAAAAGCTCCCCG
ACCTTCAAAGATCTGGACTTCCAGGAGATGCACGAAGGGC
TTTATTTTGACGCAGACACGTACAATGCCTTAATGAAGAC
GCTTCAAAGAGACTGCAGGGTTCTGGAGAGCTTTAAAATC
ATGGACTACAGTCTGCTGCTGGGCATCCATGTTCTGGACA
GGAGGATACGCAGAGGAGGCAGAGGGGACAGCAGGCGTCA
GGGGACACAGAAGGTGCTCTACTCCACCGCCAGAGAGTCC
ATTCAAGGAGACGGTAAAGCTCCTGAACCGGTCGCTGACG
CAGATGACGAAACATTGGGTGGCATCCCTGCTAAACACAA
AGATGAGAAGTTGCTGATCTTTTTGGGGATCATTGATATC
CTGCAGTCCTACAGATTTATAAAGAAAGTTGAGCACTCAT
GGAAGGCTCTTGTGCATGATGGTGATACAGTATCCGTCCA
TAGACCCAATTTCTACGCTGACAGATTCCTGAAGTTCATG
GGCAGCACAGTATTTAAAAAGATTCACCCTCTCCGCGGTG
CGTCCTCGAGACGGAAGAAAAGCTCCATTCACGTGTGTAG
ATCGGCCTCACAGGAAGTTCTGTCGACAGTAAAAGAGGAG
AGTCAAGATGAAAGAAGAGCACAAAGTCTTGAAAACCTCG
ATGATTCAGAAGAAACACACTCCTGTCAGAAACCTGATGT
TATTCCTAGCTCGGCCGGACTCAATCCAGCTGTTTCTGCG
GCCACTTTATCTTCTGCTTCATCTTTAGACGATGTGAAGG
CTGAAGCGCAGACAGATTCAGAGAGCAGAGATGATTGCAG
AGCATCCAGCTCAACTCTTGCTTTGGAGGACAGTGCTCTT
GCTTCTTTAAACTCAGCGCCAAGCACACCCGAGTCTGGTC
TGGATGTCTACCTGTGATGCGTGCGGCTTTGAGAAGTGGA
CCAGCTCATCCGTCATCTAAAAGACTGAGAAACAGTACTG
TCCGTCACTCCATGACTTTGCACTTTGGATACTGTTTGTC
AAGCTGCTAAAACACACTGACTGAGAAAAGCCTTGCATCT
GAAACAATGGTAGAGAGATTGCCACACTATAGTGCCTTAC
ACTGTCTCTGCACTTTGTACCCAATTGCAAGCACAAGTTT
GTTGTATAATAATAGTTACACTCCCATTTCGACCAGTGTC
TTATGCACCGGTTGGTACATAAGGCGTGAACCCAGATTAC
GTGTCAGATTTGTATCATTTATTATATGATAATTGTGATT
TAATTATATTTTGAGCACTCCTGACTTGTGTTGTGTTGAG
TAATGATTGCATTCACTTATTTGATCATTACAGTACAATG
ACTAGTACTGAATATTAATAACATAGGCAACATGAAGTAA
ATATTGTGTTTTTTGGTCATGTGATTTTTGACGCACAATC
AGCACAATGTAATGACATGGGATGGGGGGAGTTAATGGTC
TGTGTTACTTAGTGTAAAGATTTACATGGCTTAAAAAAAA
CATGAATCTTTAAAAATGTTTTATAAAAATGTATTTAAAT
ATATATTTTGATTAGAGTAATATATGAAATGTTTGTGCTT
TTATGTAGAATGTGTTTAGTTGCTGTTATGCTATTAAATG
CCGGATCTTTCCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations