Transcript

eif3jb-201

ID
ZDB-TSCRIPT-090929-10794
Name
eif3jb-201
Previous Names
  • eif3jb-001
  • zgc:55443-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000028291 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028291|OTTDARG00000022055|ZDB-GENE-040426-2900 eif3jb|OTTDARP00000023135 CH211-150J10.2-001 LG_ CR293520.5 Danio rerio protein_coding KNOWN, 1790 bp
GGCAGAAGCGCGTAGATCAGAGCAGCTCTGTGCACATGCT
TTCTCTCAGCTACTAGTTAAACTAACTCACAGTTAGCCAA
GATGGCGGATTCAGACGAATGGGACGCTGACAACTTCGAG
CCAAATGAGCAGATTAAAATTGCCACCGCCGGGCGGCTGG
ACAGATGGGAAGGCGAGGACGAGGAGGAAGACGTAAAGGA
TAACTGGGATGATGAGGAGGAGGAGGAGAAGGAGGAGGAG
AAGAAAGTTGAACAGAAAATAGCTGAAGTGAAACCTCCTG
AGAAGAAAAAATTAAGTGACAAAATAAAAGAGAAAGAACT
TTTGCAAAAGAAAAAACAAGAGGAGTTGAAAAAGAATCAG
GAAACAGCAGCTAGTGAGAGTCTGACGTTAGAGGAGCAGC
TAGCAGAAAAAGCTAGACTGAAAAAGCTGCAGGAGGAGGC
AGACATGGAATTGGCCCGTGAGGCTTTTGGTGTGGATCCT
GCTGCTGCAAATGCCTCAACTACTGTTAACACAACAAACG
CCTCTGGAATTGAAGCCATGTGCCCGTCATCCAAAGATGA
CTTTGTTACATTTGAAAAATTACTGAAAGAAAAGATAACA
CAGTTTGAAAAATCTGTGCATTATTCAAGCTTTTTGGAAT
CATTGTTTCGAGAACTTTGTATTTCATTGGAAGTAGACGA
CCTGAAGAAAATATCTACTTCTTTATCAGTTCTGCTCACT
GAAAAACAGAAGCAAGAAAAGGAAAAGAAGGCAAATAAGA
AAAAGAAAAAAGGTGTTGTACCTGGTGGTGGATTGAAAGC
AAACATGAAAGATGACTTTGCTGACTATGGTGGTTTTGAC
GGTGGTTACGGCAATGAATATGATGACTTCATGTGACAAA
GGATCATCGTTCCCCTTCCCATTCCCTCTGTGCTCAGACA
GCTCTGCAGACATGCAACATTACCCTTTTCATGCTACTTG
TTGCCATCTTGAAAACTGAACAATGTGTCAACCCTTTTCA
GTGGTGACAGACTCCTCATAAAGCTGCTATCAGCCCTTTG
CACCCCAGTGACAAATGGGGAGAAGCAAATTTATTCAGAT
GGCCTTGAATTTAAAATGGACTGTATGATGTGGGACATTT
TTGATGGAGGAATTTGCTGATTGGCCTAAATACGAATTTC
AATGCCTTATAGAGAACTTTGTAGATTTTTTTTTCCTCCC
TTTACTTTGTTTTTAAAGCTGTGCAATTCCAGTTTCACAA
AAGTAAATATGATTCTCTATGCAAATTAATTTCTTCCAAG
AAAGATTGGTTGTATTTTCTTGCATATTTTAGCACAATTC
GATAAAAGTTGAAAATAAAGAATCTAAATTTAATGATAAG
AATCAACAGCACGAGCAAATAGAGTGGTAAAATCAAAGTA
AAAACCGAGCATCTTAATCTGTTGAATTTTGCCCATGCCA
CAGAATTGCACAATAGCCTACTTGTGCTAATTTTTTGTTA
AGCAAAGTATATTTTAAATTAAGTCCTTACTGCTGCACGC
TTGATCAATGGTTCAATGATATTCAATTTCTACTCATCTG
ATAATGTTGAAAATTTTGGTCCTCTTTTTCTGAAGCAACA
GGTCCATGGGTATTATCATAATACAGTAGCAAGCATGTAA
AAAGTCAAATGAAATGCAGGTTTATTTATCAAAAGTGTTT
TTTTTTTTAACAAATAGTTTAATTGGACTCAGACAATACA
AAGACTCTAAGGCATTGTTTTTTTTTTTTTTTTAAGAATC
TAATTTAATAAAATCATTGGTCTAAAGGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations