Transcript

parp1-201

ID
ZDB-TSCRIPT-090929-1079
Name
parp1-201
Previous Names
  • parp1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007899 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007899|OTTDARG00000007025|ZDB-GENE-030131-3955 parp1|OTTDARP00000006993 parp1-001 LG_ BX470188.11 Danio rerio protein_coding KNOWN, 3802 bp
TAACAGAAATATCTGCAGAGATGGCCGACTCACAGGACGA
CAAGCTGTACAAAGCCGAATATGCAAAAAGCGGACGCGCC
TCATGCAAGAAATGCAAAGACAACATTGCTAAGGACTCGC
TGAGGATGGCCATCATGGTGCAGTCTCCCATGTTTGATGG
CAAAGTCCCTCACTGGCACCATTTTTCTTGCTTTTGGCTC
CGGGCCGCAGTTCAGTCTCCTTCTGATATATCTGGATTTA
CTGACCTCCGCTGGGATGACCAAGAGAAAGTGAAGACAGC
CATTGAGAGTGGAGGTGCTACAGGAGGGAAAGGAGGACAG
AAGGGAGCGGCTAAAGGAGAGAAGACGCTGAATGACTTTG
CAGTGGAGTATGCTAAATCCAACAGAAGCACCTGCAAGGG
CTGCGATCAGAAAATTGAAAAGGACCAGATCCGTGTGTCG
AAGAAGACTGTGGACCCAGAGAAACCTCAGCTTGGTCTAA
TCGATCGCTGGTACCACACCGGCTGCTTTGTGAGTCGTCG
GGAGGAACTGATATTTAAACCAGAGTACAGCGCTGCCCAG
CTCAAAGGATTCGCAGTTCTACGAGATGAAGACAAAGAGG
AGCTGAAGAAACGGCTTCCTGCTGTGAAGAGCGAAGGAAA
GAGAAAAGCTGATGAAGTAGATGGAGGAGTCTCTAAAAAA
CAGAAGAAAGAAGATGAAAAACTAGAGCAGAATCTGAAGG
ATCAAAGCCAGCTGATCTGGGGAATTAAGGACAAGCTGAA
GAAGTTCTGCTCCATCAATGACATGAAGGAACTGCTAATT
GCTAACAGTCAGGAAGTTCCTTCTGGGGAGTCAAATATTG
TGGATCGACTATCAGACTGCATGGCATTTGGGTCCCTGAA
GCCTTGTGAGACTTGCAAAGGGCAGCTTGTGTTTAAAAGT
GATGCGTATTACTGTACTGGAGACATCTCTGCGTGGACTA
AATGTGTATTCAAGACTCAGACGCCTGATCGCAAAGACTG
GGTCACCCCTAAGGAGTTCAGTGAGATCCCGTTCCTGAAG
AAGTTTAAGTTCAAGCGACAGGACCGTGTGTTTCCTAAAG
ACGCTCCTCCCGCTGCTGCCACTCCATCATCTGGTTCTAC
CACTTCAGCTGCCACAAGTGTGTCCAGCGCCAGTAAAAAC
CTCACTGAGGCACCTGCAGATAAGCCTCTGACTGGAATGA
AGCTCCTGGCTGTGGGAAAGCTCAGTAAGAACAAAGATGA
TCTGAAGAAATTTGTGGAAGATCTGGGAGGAAAAATCACA
GGCACGGCCAGCAAAGCTGCTCTCTGCATCAGCAGCAAGA
AGGAGATTGAGAAGATGAGTAAGAAAATGGAGGAGGTGAG
AGACGCAGGTGTCCGCGTGGTGGCTGATGATTTCCTTACT
GACATCAAGGAGTCCGGCAAGGCCCTTCAGGAGCTCATCT
CTCTGCATGCCATTTCCCCCTGGGGCGCTGAAGTTAAAGT
CGAGGCCCCGGCTGCAGCCGCGGCCACCAAATCCACCGGA
GCTCATTCCTCAAAGAGCACCGGCAAAGTCAAAGAGGAGG
AAGGTGGAAGCAAATCAAAGAAAATGAAGCTGACAGTGAA
AGGAGGAGCTGCAGTAGATCCAGATTCAGGTCTGGAAAAC
TGTGCTCATGTTCTGGAACAGAATGGAAAGATTTACAGCG
CCACACTGGGTCTCGTGGACATCGTCAGAGGGACAAACTC
ATACTACAAACTACAGCTGCTGGAGGATGACGTTCAAAAG
CGGTACTGGGTGTTTAGATCGTGGGGTCGAGTCGGGACCA
CCATTGGAGGAAACAAATTGGACAAGTTTTACGATAAGAA
CTCTGCTATGGACAATTTCTGTGGTGTGTATGAGGAAAAG
ACAGGGAATGCTTGGGCCTCCAGCAACTTCACAAAGTACC
CCAATAAGTTTTACCCTCTGGAGATTGACTACGGACAGGA
TGAGGAGGCTGTGAAGAAGTTGACTCAAAGTGCAGGTGCC
AAATCTCAGCTGGAAAAACCTGTGCAAGACCTCATCCGAA
TGATCTTCGATGTGGAGAGCATGAAGAAAGCCATGGTGGA
GTTTGAGATTGACTTGCAGAAGATGCCTTTGGGAAAACTA
AGCAAGCGACAGATCCAGAGTGCTTATTCCCTTCTAAGCG
AAGTTCAGCAGGCTGTGGCAGATAGCTCCTCAGAATCACT
GATCCTAGATCTGTCTAATCGCTTCTACACACTGATACCG
CACGACTTCGGCATGAAGAAACCACCACTATTGAGTAATG
TGGATTACATCCAGCAAAAGGTGCAGATGCTGGACAACCT
TTTGGACATCGAGGTGGCCTACAGCCTGCTTCGGGGAGGA
GTGGAGAACAACGAAAAAGATCCCATTGACATCAACTATG
AGAAACTCAAAACCAAAATTGAGGTCGTCGACAAGTCTTC
ACATGAGGCTCAGCTTATCCTTCAATATGTGAAGAACACA
CATGCTGCTACTCACAACACCTACACACTGGATGTTGAGG
AGATCTTTAAGATTGAGAGGGAGGGCGAGTATCAGCGTTA
TCGCCCCTTCAAAGAGTTACCCAACCGCCAGCTGCTGTGG
CACGGCTCGCGCACCACCAACTATGCTGGTATTCTGTCTC
AGGGTCTCCGCATCGCTCCTCCGGAGGCCCCAGTGACGGG
TTACATGTTTGGCAAAGGTGTTTACTTTGCTGATATGGTG
TCGAAGAGTGCCAACTACTGCCACACGTCTCAGGCTGATC
CTGTGGGCCTCATTCTGTTAGGAGAGGTTGCATTAGGGAA
CATGCATGAACTGAAGAAAGCCTCACACATTACAAAGCTA
CCAAAGGGTAAACACAGTGTAAAAGGTTTGGGAAGAAGTG
CTCCAGACCCAAGAGCTACAGTATCTCTCAATGGAGTGGA
CATTCCTCTGGGCAAAGGCATGAACACAAATATTGATGAC
ACAAGTCTGCTCTACAACGAGTACATCGTTTATGATGTTT
CTCAGGTTAACCTGAAATACCTGCTGAAGATCCGCTTCAA
CTATCAGACGTCTCTGTGGTGAGACGCCGGTTAGATCTGG
AGAGGTTTTTGGATGCCACTGAATCCCCCTGTTACAGCTT
TAGCATCAAGAACCAAACAGCACATGGGTTTAGAAATGAT
TAAATCCGTTCTCTTGCGCTTTGGCAGCACATTCCCCATT
GCTCTAGTCTGTTAGTTTGGAGTACTTTAAGTGGTTCTAC
CCAAATCACAAACTGCATTGTTGCAAATGTGGCCACCTTT
CTACAAGCAACATGATTGGACTTCTCTGTGAAATGTTTCT
TTATAAGCTACCAACAGTGGATAGGTAGACTGTCTTCCAT
ATGTTTCATAGGCCTTTTCTTTCTTTTAATAGTTTTGCTA
AACCTGGATTCAGGTTACTTGTAACACATGTAGTGTTTAC
GGTTTTGTTCGGCCTCTCGATTTAAAACAAATAAGAATGT
ACAGTTTTAGGAAAAAAATGTTGTAAGCTAGGATATAGCC
TGCTGCAAGCGAGTAATCTTTTACTAGAATTGCCAATGTA
TGAACAAGTATTTTGTATGTTAAACATGTACCAACCTAGT
TTTGCTTTTTTGAGTTTACTGTCCCTTATTGAAACGTACT
TGGGCCATTTGAAATGGCTATCAAAATCTAAGCTGCTGTA
CTCACGCACCTGTAATAAGTTTTGTTGTTGTTTTTGGCAA
ACATTTCTCCACAGTATTTGTGGACAAAATAAGTTTCCCA
AAAAATGTCTTTGCATCAAAAATAAAACGGTTTTTGGCTT
AT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations