ZFIN ID: ZDB-TSCRIPT-090929-10760
Transcript Name: eif4enif1-203
Previous Name: eif4enif1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028250 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028250|OTTDARG00000022029|ZDB-GENE-050320-113 eif4enif1|OTTDARP00000023104 CH211-13J1.1-002 LG_ CR293534.5 Danio rerio protein_coding KNOWN, 3492 bp
AAATAAATCCTCGGCGTCGGCTTGATAAGTGTAGCCAGTT
TGCTAATGAGATGCTCCTCTCTGTCAATTAACGATTCCAC
CTGGAGTGACAAGCGATATCTGAACCCCCTTCAACACCGT
CGATAGAGAAACTTTATTTTTATGCAGGAAACTTCATCCG
CGTCCTTTCTGAATTCTGGACTGACTCCGGCATTTCTTGT
AGTTTGGTATAAGACAGGTAGCCAGAAGCTAGCTAACTGA
GGTAACCCGGCGGGGACAGAGAAGGTGCTGTGACACCGTT
TCAAATATCAGGTGCCTAGAGCGTCTGGTATTTGGGCTTC
TCTTCAGTTTGACCAGCCACCACAGTCATGGAGAAGGACG
AAAATGGTGAAAACTTGGTGGACCCAATTAAGGACTCCGT
AATGACCTCTGCCTATAGGTATACCAAGGAAGAGCTTATG
GAAATCAAAGAATTGCCAATTTCAAATGAGAGGCCAGAAT
GTCTGTCAGAGAAATATGACAGCGATGGCGTCTGGGATCC
TGAAAAATGGCATGCTTCACTATATCCCTCTTCAGAGTCC
AGTTGTCCTACAGAAGGTTACAAGAAAGACTATGTAGACG
ATAGGGTGCCACTTAAACGAAGAATTGCAGATCCCAGGGA
ACGTGTAAAAGATGATGATCTAGAGGTGGTTCTAAGTCCG
CAACGTCGTAGTTTTGGTGGTGGCTGTCAAGTTGCACAAA
CCGCCCTCCCTCGCCGACCCACCAGCCCTCTGGAGAACAA
AGAAAATGAGTCTCTCCGTTTGGGGGGAGCACGACGCATC
GGCAGTGGCCGCATCATGGCATCACGCGTTTTTGAAAGGG
ATGCACGGGTTGACAAAGAGAGGGAGCGAGACCGAGAGCG
TGACTTCAAGGATAAGCGATTTAGGAGAGATTTTGGAGAC
AAAAGAGTGTTCAGTGAGAGGAGAAGAAATGACTCGTATG
CAGAAGAGGAGCCAGAGTGGTTCTCTGGTGGACCCACTAG
TCAGTCTGAGACCATTGAGCTCATTGGCTTTGATGACAAA
ATCTTGGAGGATGACAAACGGAGGACCAAACGTTCCAAGA
AGAGGCCAGAGTCCGTTAAAGAAGTTGAATGCAATGGTGG
ACTTTCAGACGGCCCTGAAGTAGTTCGGGAGTCAGGAGCT
GATCAAGAGGTTCCACATGCTGAGCTTCCTGAGCAAACCC
CTGGAGATTTTGACTTCAATGAGTTCTTCAATCTTGAAAA
GACCATGCCTGGTCTGGCTTCGCCACAGCAGCAGTCAGTG
GATCCTGTTCTTGTGTCCTTGACTGAGGCACAGGTACCTG
CACCTCAGCAAAAAAACATCTTTCAGGAGTTGTTGGTTAC
CCCCCATGGCCCTGTTCCTGTACCAGGCCTCATACACCAC
CGTGCTTCACCCCCACTTTTCCCACAGAGATCACAGATGC
AGGACTTTTTCCCAGGCATGTCACCTGCAACCGGGTTCCA
TGGTGGTCCGCAAACAGTGTTGGATCAAATTCCAGACTTG
CACCGGGCCAGGAATACACAACCGATGAGAGCTTTGCCAA
TGGGAGTGGACCAGACCAATCTTGAAGCTTTGTTTCAGCA
GGATTTGGCAGTTCTTAATCGCCCACAGTACCAACAAGCC
TACAACAAACAGGCTCATGATAAGATGTTTCGTAACAGGC
CAACTCGGATGAACCGTTCACCTGTTCCTCACTTACCTGG
CCGGACATCACCTGGCAGTACAGTTACAAGTGTCTTGTCT
CCATCCTTCACTCCCACCTCTGTGATCAAAAAAATGTATG
AGTCAAAAGAGAAAAGTCGGGATGATCTTGGGAGTAGACC
AGGAAGCAAAGAGGAGACTGTGAACTCTCATAACTCACAG
GACGATGGACCTCCATCTCCCAGTTCCTTCCTGGAAGACG
TAGACACCAGTGGTCCTCAGACTGGTGGGGTAAAAGCCTG
CTCCACCCCTGTTCCCACTCAAAACCGCCATATCAAAGAC
CCAGAGCGGCCCAGGCCACCATCGGTAACAGGCCCCCACA
CTCCCACCATGCTGTCCCCAGGGCCTTCGTCTCCTTTCCC
CAGACCCCAGATGTATCCGGTCCCTCTGCTTCCTCACGTC
CCCTTGGTCAGACCTCCACCCCAGCTTCACCCCGGTGTGA
TGCAAAGGATGCTGGCTCAGGGCATCCAGGCTCAACAGCT
CGGACCCACATTATTACAAACAGGCATGTTTCCTCAGGCT
GTGGACCTGTCTCAGCTTCAGGGTTTGCCTCCAGCACTTT
TAGGACAGCCTCTGTATCCACTTAGTCCTGCTGGACATCC
GCTTATGGCCCCCAGAGCTGCAGGAACACACGTGCAGTTA
GCAGTCATGCAACAACAGCTACAACAGCAGCAGAGACCCA
ATCTTCATGTGGCTCCCTCAGGAGGCCCCCAGTCCCAGAG
CCACGGTCCCCATCGGACAAACCAGCGGAGAGGTGCAAGT
CCCCCTCTGGGCCTGGCCAAGTGGTTTGGTTCAGACATGC
TGCAGCAGCCTCTCCCTTCCATGCCTTCCACTAAAGTGAT
CAGTGTTGATGAGCTCGAGTTCCGCCAGTGATGACAATCC
TCTGACCAATCAGCAGGAGTGAAGCAACACAAACCTTCCC
TTCCCCATGATCCTCTAGTTGGAGATATGTGAACTTTTTG
ATTTCTACCATTGTGTACAGATGTCAGAGCCCCGTCTATA
TTTTTTTTCTTTTCCTGTGCTCTGTCGGAATCCCTTGCAG
TTCTGTTTTGTTTATTCTTTAAGAAGGCCTGAAGTTGAGA
AGGAAAATGTTTTATTTTTCCTGCCGCTGTCACGATGTAG
GATGTTTTGTTCTTCTGGAGATTTCAGATTTTGCAGTAAA
GTAAATAATGTATAGGCCTGAATTGTACAGATTATGGGAA
TTGATTTTCTTTTTCCATCTTGTACAAAGAAGTGACTTTT
TTTCTTTTTGGTTTTCCTTCTGTGCTTGTGGGGAAGGTTC
TCCTGCTGTTGGGGAACAGAAAACGTGCTCGCTCTTTGTC
CAGTCACACAATGTCTGCACAATGTTTTCCATGTAAAGTT
GATTATGAATGGGCGGCACTGCTAGTTTGTTGGAAAGGAG
ATGTTCCCATTTGTAGCAGTTTAATGCATCCCGGATCCAG
AGATACAGGCCCTTGAAACTTTTGCTGGAATATTGAAGCC
AGAATGTTCTCAAAGAGGGGACACTCTTCCAACCCAAGAA
GCAAATGCTAGTTGTGCCTTTGTTTCCTTTTTTTTTTTTT
TCCTTTTTCTTTTTCTTTTTTTTTTTTTTTAAAGAGAAAA
ACCCTCCCATCCTCCTCTAGCCAGTCTTCTTAGTCACTGT
ATGAGAAGCACTGCTCTGAATCACATTTGTTTTAGGGTGG
CAGGGGTTCGCAATTAAGTAATGTGCTATTAATTTAAGAA
GCACAAATAGTTAATAAATATAAAAAGCTAAATAAAAAAA
TCATTCACATAA

eif4enif1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA eif4enif1-202 (1) 4183
eif4enif1-203 3492
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eif4enif1-203 Contained in:
OTHER eif4enif1-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028250 (1)
  • Ensembl_Trans:ENSDART00000145153 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090823 (1) 3506bp
    GenBank:CD590192 (1) 436bp
    CITATIONS (2)