ZFIN ID: ZDB-TSCRIPT-090929-10748
Transcript Name: isoc2-201
Previous Name: isoc2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028237 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028237|OTTDARG00000022020|ZDB-GENE-070518-1 isoc2|OTTDARP00000023094 DKEY-38O19.4-001 LG_ CR848818.10 Danio rerio protein_coding KNOWN, 912 bp
CATTTCAAAAAATGAATCATTCGACATTGAACTATCTGAA
GAGTTCCAACACCAGTTTTACCAATAAGATCAGTGGGTGG
ACACATACATAAACACTGTCTGTCTTTACTTGATCTCTGC
GGTCTAAGAGTCCTCCATACTGCACTGCAAACATGGCAGG
AATTGGTAGACTGTCCACCAAAGGCTCTGTGCTGCTGCTG
TGTGACATGCAGGAGAAGTTCAGACCCACTATTTTCCAGT
TTACAAACGTCGTGAGCAATGCTGCAAGATTGTTACAGGC
ATGTCGAATCTTAAACATCCCTCAGATTTTAACCGAGCAG
TACCCCAAGGGTCTAGGCCCCACTGTTCCTGAGCTGGGAG
CAGAGGGCCTGAAGCCTCACACAAAGACCAGTTTCTCTAT
GATGACAGAGAGCGTGCAGAGCTCACTCAAGAGCATGGGA
GACCCTCAGCAAGTCATACTGTGTGGCATCGAGGCTCAAG
CATGCATTGCGTGCACAGCCTATGATCTCCTGGAGAGAGG
AATGGAGGTTCATATTGTAGCTGACGCTGTGTCCTCTAGA
AGTCAAACAGATCGTCTTTTTGCACTGTCACGGTTGAGGC
AGAGTGGGGTGTTTCTCAACACTACAGAGGGAGTTTTACT
GCAACTAGTGCAGGATGCCAAGCACCCCAACTTTAAAGAG
ATCCAGAAACTCTTGGCTCACCCCTCCCCTGATACAGGCC
TGCTGGCCTTCTTCAGCTCTCTATAGGGCCAGTCAAACAC
AGACCACACCCTGCAGACATAATTACAGAAATTATTAAAA
ATCAACACACACTGTTGTGTCAACCTGATGAACTCATGTG
AGATCTGTGCATTTACATCCTTTCACAGAAACACAGATAA
TTAAAATGTTTAAATAAAACAAATGCAAAAAA

isoc2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA isoc2-201 912
isoc2-202 (1)    Ensembl 863
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
isoc2-201 Contained in:
[BAC] DKEY-38O19 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000028237 (1),  Ensembl_Trans:ENSDART00000007842 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC125848 (1) 928 nt
CITATIONS (2)